ID: 1055261358

View in Genome Browser
Species Human (GRCh38)
Location 9:74437568-74437590
Sequence CAAGTCAACCAGGCCTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055261351_1055261358 27 Left 1055261351 9:74437518-74437540 CCTTCTGGGCAGCTGTCATATCT No data
Right 1055261358 9:74437568-74437590 CAAGTCAACCAGGCCTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055261358 Original CRISPR CAAGTCAACCAGGCCTAAGC TGG Intergenic
No off target data available for this crispr