ID: 1055266242

View in Genome Browser
Species Human (GRCh38)
Location 9:74498473-74498495
Sequence CAGCAGGCATGTCCCTTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055266238_1055266242 -6 Left 1055266238 9:74498456-74498478 CCACTAAGCGTCCTGGCCAGCAG 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1055266242 9:74498473-74498495 CAGCAGGCATGTCCCTTCGCTGG No data
1055266235_1055266242 8 Left 1055266235 9:74498442-74498464 CCAGGTTACGAGGCCCACTAAGC 0: 1
1: 0
2: 1
3: 1
4: 20
Right 1055266242 9:74498473-74498495 CAGCAGGCATGTCCCTTCGCTGG No data
1055266237_1055266242 -5 Left 1055266237 9:74498455-74498477 CCCACTAAGCGTCCTGGCCAGCA 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1055266242 9:74498473-74498495 CAGCAGGCATGTCCCTTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055266242 Original CRISPR CAGCAGGCATGTCCCTTCGC TGG Intronic
No off target data available for this crispr