ID: 1055267954

View in Genome Browser
Species Human (GRCh38)
Location 9:74519874-74519896
Sequence GTGAATTAAAGAATGATCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 485}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055267954 Original CRISPR GTGAATTAAAGAATGATCAA CGG (reversed) Intronic
902491476 1:16785255-16785277 GTGAATTAGAGAAAATTCAACGG + Intronic
902773974 1:18662399-18662421 ATGAACTAAAGAAGGAACAAAGG - Intronic
903864987 1:26391595-26391617 ATGAATGAATGAATGAACAACGG + Intergenic
904051408 1:27641556-27641578 CTGATTTAAGGAATCATCAATGG + Intergenic
904204483 1:28844589-28844611 GTTAATTAAAAAATGAACAAGGG - Intronic
904283810 1:29440856-29440878 GTGAAATTAAGAAAGAACAAAGG + Intergenic
904393358 1:30199965-30199987 GTGAATTAAAGGATGTTAGAGGG + Intergenic
905090629 1:35428787-35428809 CAGAATTAAAGAAAGATCAAAGG - Intergenic
906969687 1:50498558-50498580 GCTAATTAAAAAATGGTCAAAGG + Intronic
907114002 1:51952669-51952691 ATGAATAAAGGAATGAACAAAGG + Intronic
907666033 1:56434662-56434684 ATGAATTAAAGAATGAACTGGGG - Intergenic
908023952 1:59928199-59928221 TTGCATTAAAGAATGATGCAGGG + Intergenic
908672575 1:66564298-66564320 GTGAATTATAGAAGAGTCAATGG - Intronic
908907022 1:69027154-69027176 GGAAATTAAACAAAGATCAAAGG - Intergenic
909703738 1:78555665-78555687 GGGAATTACACAATGATAAAAGG + Intergenic
910695829 1:90014524-90014546 GCTAATTAAGGAATGGTCAAAGG + Intronic
910850632 1:91646761-91646783 GTCAATAAAAAAATGAGCAAAGG - Intergenic
912588730 1:110791948-110791970 GGGCATTAAATAATGATAAAGGG + Intergenic
916393175 1:164355559-164355581 CCTAATTAAAGAATGAGCAAAGG + Intergenic
916450110 1:164912612-164912634 GTGAATTTAACAATGGTGAAAGG + Intergenic
916616474 1:166446387-166446409 GTTAATTAAGTAATGATTAAGGG + Intergenic
916621274 1:166500311-166500333 ATGCAATAAAAAATGATCAAGGG - Intergenic
916884587 1:169054668-169054690 TTTAATGAATGAATGATCAAAGG + Intergenic
917673394 1:177296091-177296113 GGGCATTAAATAATGATAAAGGG - Intergenic
918455559 1:184709121-184709143 ATGACTTAAAGAATGATGATAGG + Intronic
919107871 1:193176485-193176507 GAGCATTAAAGAATCATCATAGG + Intronic
919411336 1:197246657-197246679 GTGATTGAAAAAAAGATCAAAGG + Intergenic
919535114 1:198777736-198777758 GTGAAGTACACAATGATCACAGG + Intergenic
921511250 1:216033529-216033551 GAGAATAAAAGAATGATATAAGG + Intronic
922046656 1:221951736-221951758 ATGAATGAAAGAATGAGGAAAGG - Intergenic
922242668 1:223766098-223766120 ATAAATAACAGAATGATCAATGG - Intronic
923222665 1:231910025-231910047 GTGCAATAAAAAATGATAAAGGG - Intronic
923496526 1:234530584-234530606 GTGTATTAAACACTTATCAATGG + Intergenic
923501276 1:234566959-234566981 GTGAATTAAAGGAGTATTAACGG + Intergenic
923528969 1:234797287-234797309 GTGAATTAGAGAAAATTCAACGG - Intergenic
924370354 1:243341292-243341314 GTGATTTCAAGAATAATAAAAGG + Intronic
924886768 1:248227129-248227151 GTGCATTACATAATGATGAAGGG - Intergenic
1063438323 10:6052464-6052486 CTGAATGAATGAATGAACAAAGG + Intronic
1064163762 10:12969123-12969145 GTCAATTAAAAAATGGGCAAAGG + Intronic
1064777687 10:18797193-18797215 GGGAATTATATAATGATAAAGGG + Intergenic
1065543824 10:26798419-26798441 GTGACTTAAAGATGGATGAAGGG + Intronic
1066230820 10:33431270-33431292 ATGAATAAAAGAATGTACAAGGG + Intergenic
1067786051 10:49248765-49248787 GTGTAATAAAAAATGATAAAGGG + Intergenic
1070209151 10:74296912-74296934 GTGAATTAAAGAATACTTAAGGG - Intronic
1071232730 10:83607524-83607546 GTGAACTAAGGAAAGATGAAGGG - Intergenic
1071232906 10:83609719-83609741 GGGAATGAAAGAATGAAGAAGGG + Intergenic
1071740525 10:88353049-88353071 GTGCAATAAAAAATGATAAAGGG - Intronic
1071896864 10:90077081-90077103 TTAAATTAATGAATGATGAAGGG - Intergenic
1072417053 10:95257481-95257503 CTCGATTAAAAAATGATCAAAGG + Intronic
1073016230 10:100401737-100401759 ATCAATTATAGAATGTTCAAGGG - Intergenic
1073559291 10:104483057-104483079 TAGAATTTAAGTATGATCAAGGG - Intergenic
1074819914 10:117170204-117170226 GTGAACTCATGAATGATCACTGG - Intergenic
1075958142 10:126543057-126543079 GTGATTTAAGGAATTTTCAAGGG - Intronic
1077715099 11:4572804-4572826 GGGAATTACATAATGATAAAGGG - Intronic
1078885012 11:15491265-15491287 GTGAATTAATGAGTGAGCAAAGG - Intergenic
1079484520 11:20921356-20921378 ATGAATTAAAGCAAGCTCAAAGG - Intronic
1079849173 11:25508946-25508968 GTGAATTAAAGATTCAGAAATGG - Intergenic
1079977590 11:27111039-27111061 GTGAATTAAAAAAAGAACTAAGG - Intronic
1080594244 11:33755429-33755451 ATGAATCAAAGGATGTTCAAAGG + Intronic
1081176963 11:39939768-39939790 TTGAATTTAAAAATGAGCAAAGG - Intergenic
1081354729 11:42098491-42098513 GTGAATGAAGGAAAGAACAAAGG + Intergenic
1083526982 11:63376955-63376977 GAGAATTACATAATGATCCAGGG + Intronic
1083692344 11:64417598-64417620 ATGAATTAAAGAATGGGCAAAGG + Intergenic
1083972063 11:66084332-66084354 GTGAATTAAAGAGAGAGTAATGG + Intronic
1085373999 11:76041120-76041142 CTCAATTAAAAAATTATCAAAGG + Intronic
1086661376 11:89423097-89423119 TTGATTTAAAGAAGGATCAGAGG - Intronic
1086687277 11:89747344-89747366 ATGAAATAAAAAATGATAAAGGG + Intergenic
1087352250 11:97046610-97046632 GTTAATTTAAGAATCATCAATGG - Intergenic
1087882903 11:103439780-103439802 CTGAATGAATGAATGAACAAAGG + Intronic
1088046641 11:105460064-105460086 GGTAATTAAATAATGATAAAGGG + Intergenic
1089318652 11:117610002-117610024 GTCAGTTAAAGAGTGATCACTGG - Intronic
1089819807 11:121214114-121214136 GGGCATTAAATAATGATAAAAGG + Intergenic
1090537752 11:127663160-127663182 GTGATATAAACAATGATAAATGG + Intergenic
1093287281 12:17280478-17280500 TTGAATTAAGAAATGATCACAGG + Intergenic
1093857005 12:24117130-24117152 CCCAATTAAAAAATGATCAAAGG + Intergenic
1093927025 12:24919060-24919082 TTAAATTAAAAATTGATCAATGG + Intronic
1094209680 12:27875951-27875973 GACAATTAAAAAATGAGCAAAGG - Intergenic
1095787284 12:46123457-46123479 ATGAATTAAAGAAAGTTGAAGGG - Intergenic
1097736021 12:63181749-63181771 TTGAGTTAAGGAATGATAAAAGG - Intergenic
1097985017 12:65773804-65773826 ATGAATGAATGAATGACCAAAGG + Intergenic
1098280125 12:68854278-68854300 CTGAATGAATGAATGAACAAGGG - Exonic
1098375054 12:69806345-69806367 GTGCAATAAAAAATGATAAAGGG - Intronic
1098671281 12:73234327-73234349 GGTCATTATAGAATGATCAATGG + Intergenic
1098782307 12:74702260-74702282 GTGAAGTAAACAATATTCAAAGG + Intergenic
1098905398 12:76156652-76156674 GTTAATTAGACAATGATCAAAGG + Intergenic
1099055649 12:77836617-77836639 TTGAATTAAAGTTTGTTCAAAGG + Intronic
1099256032 12:80312941-80312963 GTGCATTAAAAAAGGAGCAAGGG - Intronic
1099341618 12:81443803-81443825 AGGTATTAAAGAATGATTAAGGG - Intronic
1099465213 12:82976806-82976828 GTGAAGTAAAAAATGATCATCGG + Intronic
1099732503 12:86523822-86523844 GGGCATTAAATAATGATAAAGGG - Intronic
1099846766 12:88036592-88036614 TTGAATTAAAGAATGAACCCTGG + Intronic
1100148886 12:91711122-91711144 ACGAAATAAAGAATGATAAAGGG - Intergenic
1100149249 12:91715372-91715394 TTGATTTAAAGAATGAATAAAGG + Intergenic
1100245725 12:92754650-92754672 GTGATTTAAGAAATGATGAATGG - Intronic
1100509432 12:95254940-95254962 ATGAATTTAAGAATAATCACAGG - Intronic
1100589101 12:96008271-96008293 TTTCATTAAAGAATTATCAAGGG + Intronic
1101484224 12:105136111-105136133 GTGAATTAAACAACCATCACAGG - Intronic
1102649085 12:114424478-114424500 GAGATTTAAACAATTATCAAGGG - Intergenic
1107094802 13:36524841-36524863 GTGAATTAAACAATAATGAGTGG - Intergenic
1107262349 13:38509152-38509174 GGGAATTACATAATGATAAAAGG - Intergenic
1107592255 13:41920581-41920603 ATGAAATAAAAAATGATAAAGGG + Intronic
1108097582 13:46920489-46920511 GGGAATTACATAATGATAAAGGG - Intergenic
1108468116 13:50739409-50739431 GTGAATCCATGAATGAACAAAGG + Intronic
1108634880 13:52323462-52323484 GGGAATTAAAAAATGAAAAAAGG - Intergenic
1108652926 13:52499726-52499748 GGGAATTAAAAAATGAAAAAAGG + Intergenic
1109327263 13:60882931-60882953 GTCATTTAAAGAATAAGCAAAGG + Intergenic
1109350052 13:61168735-61168757 GTGAAGGAAAGAATGAACAAAGG - Intergenic
1109387886 13:61656486-61656508 GTGATGGAAAGAAAGATCAAAGG - Intergenic
1109504555 13:63283380-63283402 GTCAACTAAAGATGGATCAAAGG - Intergenic
1109640371 13:65183656-65183678 GTGTATTACATAATGATAAAGGG - Intergenic
1110755707 13:79171614-79171636 GTCAATTACAGTATTATCAAGGG + Intergenic
1111325400 13:86688244-86688266 GTGAATTAAAAAATAATGTACGG - Intergenic
1111347025 13:86972202-86972224 GTAAATTAAAGAATGCTTCATGG - Intergenic
1111574645 13:90136229-90136251 GTGGAGTAAAGAATGAGAAAAGG - Intergenic
1111845832 13:93507310-93507332 CCAAATTAAAGAATGATAAATGG - Intronic
1113106835 13:106781095-106781117 GTGCAATAAAAAATGATAAAGGG - Intergenic
1113200373 13:107860872-107860894 ATGAATTAAAGTATTAACAAAGG - Intronic
1113823334 13:113231309-113231331 GTGCTTTGAAGAATGAGCAAAGG + Intronic
1114341264 14:21747172-21747194 GTGAAAGAAAAAATGACCAAGGG + Intergenic
1114747926 14:25170343-25170365 ATGCAATAAAGAATGATAAAGGG + Intergenic
1115065081 14:29249936-29249958 GGGCATTAAATAATGATAAAGGG - Intergenic
1115259704 14:31438955-31438977 GTGATTTACACAATAATCAATGG - Intronic
1115937114 14:38564496-38564518 GTGTATTATATAATGATAAATGG + Intergenic
1116104332 14:40480872-40480894 CTGAATTTAAGAATGGCCAAAGG + Intergenic
1116441384 14:44957971-44957993 ATGAAATAAAGAAGGATCCATGG + Intronic
1116546936 14:46180350-46180372 GTGCAATAAAAAATGATAAAGGG - Intergenic
1116708123 14:48329740-48329762 GTGAAATAAAGAATAACCAGAGG + Intergenic
1116738309 14:48722753-48722775 GTGAATTTATGACTGATGAAAGG + Intergenic
1116945751 14:50833604-50833626 GTTAACTAAAGAATAATCCAGGG + Intergenic
1116974220 14:51097510-51097532 ATGAATGAATGAATGAACAAAGG - Intergenic
1118590107 14:67394814-67394836 ATGAATTAATGAATTATCATGGG + Intronic
1118929446 14:70226940-70226962 ATGAATTGAAGAATGTTCAATGG + Intergenic
1120716637 14:87847708-87847730 GTGATGTGAAGAATGCTCAAAGG - Intronic
1120825471 14:88950958-88950980 GTGAGTTAAAGAAAGATAATGGG - Intergenic
1121167057 14:91813247-91813269 TTGAATGAATGAATGACCAATGG - Intronic
1121213723 14:92230284-92230306 GTGCAATAAAAAATGATAAAGGG - Intergenic
1121398231 14:93646953-93646975 GTGAATGAATGAATGAATAAAGG - Intronic
1121808015 14:96849207-96849229 GTGAATTAAAGACTGTCTAAAGG + Intronic
1122161729 14:99789530-99789552 GTCAATTAAAGAGTCATCATTGG - Intronic
1122790130 14:104180870-104180892 GTGAATTAAAGATGCATCGATGG + Intronic
1125355452 15:38812868-38812890 GAGAATCAAAGAATAATCCAAGG - Intergenic
1125922468 15:43533423-43533445 GTGAATTCAAGAATGAATATAGG - Intergenic
1126177340 15:45749005-45749027 GTTGATTAAAAAATGAGCAAAGG - Intergenic
1126774391 15:52087588-52087610 GTGATTTAAAGAATCATCTTGGG - Intergenic
1127588916 15:60403195-60403217 GTGAGTTTAAGTATGAACAAAGG - Intergenic
1129638020 15:77343282-77343304 TTCAATTAAAAAATGATCAAAGG - Intronic
1129929262 15:79395991-79396013 CTGAATTGAAGCATTATCAAAGG - Intronic
1131478042 15:92757904-92757926 ATGAAATAAAAAATGATAAAGGG + Intronic
1131694328 15:94858944-94858966 GTGAATTAAAAAAAAATCCAAGG - Intergenic
1131912284 15:97221090-97221112 GTGAATGAAGAAATGAACAATGG - Intergenic
1134125778 16:11615064-11615086 GAGAATGAATGAATGAACAAAGG + Intronic
1135698191 16:24609146-24609168 GTGAATGAAAACATGAGCAAAGG + Intergenic
1136652180 16:31682381-31682403 GTGAGTTATAGAATGTCCAATGG + Intergenic
1136671803 16:31865148-31865170 GTGAGTTACAGAATGTCCAATGG + Intergenic
1137397974 16:48130360-48130382 GTGAATAAATGAATGAATAAAGG + Intronic
1137465607 16:48706103-48706125 CTGAATTAATGAATGATTAGCGG - Intergenic
1137481816 16:48858255-48858277 GTGAATGAGAGAATGAAGAAAGG - Intergenic
1138437285 16:57010199-57010221 GAGAATTAAATAATGCTGAAAGG + Intronic
1139448984 16:67015408-67015430 CTGCATTAAAGAATGAGGAAAGG + Intergenic
1140906163 16:79411072-79411094 GTGAATAAAGGCAAGATCAAAGG - Intergenic
1142901808 17:3016956-3016978 GTGACTGATGGAATGATCAAAGG + Intronic
1143311005 17:5989178-5989200 GGGAATTAAAGATTAAACAAAGG + Intronic
1143394023 17:6577562-6577584 GGGAATTACAGAATGATGTACGG + Intergenic
1144369907 17:14580151-14580173 GTGAACGAAGGAATGAGCAACGG - Intergenic
1144767832 17:17742447-17742469 GTGAATGAATGAATGAATAAAGG + Intronic
1146270337 17:31481100-31481122 ATGAATTAAAGAATGAATGAAGG + Intronic
1151382485 17:73735396-73735418 ATGAATGAATGAATGATTAATGG + Intergenic
1152324738 17:79629002-79629024 TTGAATCAATGAATGAACAAAGG - Intergenic
1153778727 18:8476271-8476293 ATAAATTCAAGAATGACCAATGG + Intergenic
1155427274 18:25719743-25719765 ATGCAATAAAGAATGATAAAGGG + Intergenic
1155508587 18:26554125-26554147 GAGAAAGAAAGAATAATCAAGGG + Intronic
1156387061 18:36614819-36614841 ATCAATTAAAAAATGAGCAAAGG - Intronic
1156431166 18:37076626-37076648 ATGCAATAAAAAATGATCAAGGG + Intronic
1157172070 18:45416851-45416873 GTGTATTAAAACATGATCTATGG - Intronic
1157266095 18:46223696-46223718 CTGAATAAAAGAATGATTGATGG - Intronic
1157411710 18:47468595-47468617 GTGAAATAAAGAATGGTGGATGG + Intergenic
1158073505 18:53501162-53501184 GTGCATTAAAGATTCATTAAAGG - Intronic
1158438693 18:57454093-57454115 ATGAATTCAAAAATGTTCAAAGG - Intronic
1158902514 18:61979057-61979079 GTGAAATAAAAAATAATCAGTGG - Intergenic
1159123975 18:64201628-64201650 GTGAATTAAAAAGTGAACAATGG + Intergenic
1159324632 18:66898644-66898666 GAGAATTATATAATGATGAAAGG - Intergenic
1159581649 18:70240010-70240032 ATGAAATAAAAAATGATAAAGGG + Intergenic
1160108110 18:75998361-75998383 GTGAATCAAAGAAATCTCAAAGG - Intergenic
1160414584 18:78699350-78699372 GAGAACTTAAGAATGCTCAATGG + Intergenic
1162799339 19:13102450-13102472 ATGAATGAAGGAATGAACAAAGG + Intronic
1162875225 19:13616399-13616421 ATGAATGAATGAATGATGAATGG - Intronic
1163940284 19:20485723-20485745 GTGCAATAAAAAATGATGAAGGG + Intergenic
1163963569 19:20721485-20721507 ATGAAATAAAAAATGATAAAAGG - Intronic
1163975175 19:20844284-20844306 ATGAAATAAAAAATGATAAAGGG + Intronic
1164490872 19:28713328-28713350 GTGAGGTTAAGACTGATCAATGG + Intergenic
1164688381 19:30187508-30187530 ATGCAATAAAGAATGATAAAGGG - Intergenic
1164799946 19:31068076-31068098 TTGAATGAATGAATGAACAAAGG - Intergenic
1164909496 19:31994026-31994048 GTGAATAAAAAATTAATCAATGG + Intergenic
1165506664 19:36235882-36235904 GTGTAGGAAAGAATCATCAAGGG + Exonic
1166345951 19:42165938-42165960 ATGAATGAATGAATGAACAAAGG - Intronic
1166509924 19:43399307-43399329 GTGACTTAAAGATTGATCCATGG + Intergenic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1167633069 19:50637897-50637919 TTGAATGAATGAATGATGAATGG - Exonic
928227061 2:29459212-29459234 GTAAATTAAGGAGTGAACAAAGG - Intronic
928576679 2:32662617-32662639 GTGCACTAAAAAATGATAAAGGG - Intronic
928595740 2:32857259-32857281 GTGAATAAAAGAGTTATGAAGGG - Intergenic
928798660 2:35058341-35058363 GGAAATTAAATAATGATAAAAGG - Intergenic
928905329 2:36361544-36361566 GTGGACTAAAGAATGACGAATGG + Intronic
929288564 2:40163851-40163873 GTAAATTAAAAAATAATTAATGG + Intronic
930230954 2:48843382-48843404 CTGAATAAATGAATAATCAATGG - Intergenic
930424749 2:51198395-51198417 ATGAATGAAAGAATAGTCAAAGG - Intergenic
930437294 2:51361541-51361563 GTGCAATAAAAAATGATAAAGGG - Intergenic
931415588 2:62077534-62077556 GTGAAGTAAAGTATGATAATAGG - Intronic
931518405 2:63069062-63069084 GTGAATTAAAGAAAAATAACAGG - Intergenic
931526483 2:63160828-63160850 GTGAAGCAAAGACTGATTAATGG - Intronic
931652187 2:64478617-64478639 GTCAATTAAAGAATAAAAAATGG + Intergenic
931677931 2:64716729-64716751 GTGTGTTAAACAATGAACAATGG - Intronic
931932590 2:67156847-67156869 CTCAATGAAAGAATGTTCAAAGG + Intergenic
931945016 2:67296768-67296790 ATGAATGAATGAATGAACAAGGG - Intergenic
931981737 2:67700385-67700407 GTAAATTAAAGAAAAATCATAGG + Intergenic
932237612 2:70133619-70133641 GTGAATTGAACAACGCTCAAGGG - Intergenic
933091238 2:78120251-78120273 GTGAAATAAAGGATTAGCAAAGG - Intergenic
936848760 2:116871038-116871060 GGGAATTAAATAATGGTAAAGGG - Intergenic
937516207 2:122658309-122658331 ATTAATTAAAGAAAGATCCAGGG - Intergenic
937622927 2:124009677-124009699 GTGAATTAAAAAATAAAAAAAGG - Intergenic
937748554 2:125445805-125445827 GTGAATTCAAGTATGAGGAAGGG + Intergenic
938925195 2:136033196-136033218 GAGCATTATAGAATGTTCAATGG - Intergenic
939480937 2:142746353-142746375 GTGAATTAAACAATAATAGATGG - Intergenic
940121578 2:150273776-150273798 GTGAATTAATGGGTTATCAAAGG - Intergenic
940321924 2:152386496-152386518 ATGAGTTAATGAATGGTCAAAGG - Intronic
941057037 2:160800614-160800636 GTGCAATAAAAAATGATAAAGGG + Intergenic
941964561 2:171288058-171288080 TGGAATTAAAGAATTATAAATGG + Intergenic
943076969 2:183207517-183207539 GTGAATTAAAGCATGACAAATGG - Intergenic
943698118 2:190958284-190958306 GTGCAATAAAAAATGATAAAGGG - Intronic
944197072 2:197065592-197065614 ATGAAATAAAAAATGATAAAGGG + Intronic
944994691 2:205280312-205280334 GTGAAGAAAAAAATCATCAAAGG + Intronic
945042868 2:205756698-205756720 GGGAACTAAAGAATCATCAAGGG - Intronic
945184897 2:207130217-207130239 TTGAATGAAAGAATGATGAGTGG - Intronic
945279925 2:208026348-208026370 CTGAATAAATGAATGAACAAAGG + Intergenic
945352971 2:208803928-208803950 GTGCAATAAAAAATGATAAAGGG + Intronic
945884245 2:215358091-215358113 GTGAATAAAGAAATGATCAGGGG - Intergenic
946294090 2:218769508-218769530 GTGCAATAAAAAATGATAAAGGG - Intergenic
946386241 2:219386141-219386163 GTGAAGTAAAGACTGACCACTGG - Intronic
946717022 2:222563468-222563490 GTGAAATAAAGGATGAGCATAGG + Intergenic
1169643779 20:7785956-7785978 GTGAATCAAAGAAGCAACAAGGG + Intergenic
1170637913 20:18124806-18124828 ATGCATTAAAAAATGATAAAGGG - Intergenic
1171179121 20:23079031-23079053 GAGAATTAAAGAGTGATGAGGGG + Intergenic
1171245884 20:23609064-23609086 TTGAATTAAAAAATGACAAAAGG + Intergenic
1171722229 20:28574674-28574696 GTGCAATAAAAAATGATAAAGGG - Intergenic
1171755863 20:29108836-29108858 GTGCAATAAAAAATGATAAAGGG + Intergenic
1171861841 20:30407917-30407939 GTGCAATAAAAAATGATAAAGGG + Intergenic
1172473110 20:35215586-35215608 GGTAATTAATGAATGAACAAAGG + Intergenic
1172819809 20:37721799-37721821 GTTATTTAAAGAATGATCACTGG - Intronic
1173052753 20:39580521-39580543 GTCTATTAAAGAATTAACAAAGG + Intergenic
1173373163 20:42458317-42458339 TAGAATTAAACAATGATCAAGGG + Intronic
1174175380 20:48641214-48641236 GTGAATTAAAGAAGTGTTAAGGG - Intronic
1174279754 20:49430664-49430686 TTGAATTAATGAATGAATAAAGG - Intronic
1174738836 20:52992257-52992279 ATGAATGAATGAATGAACAAGGG + Intronic
1175044257 20:56089605-56089627 GAGAATTAATGAATGATCCTTGG + Intergenic
1175645680 20:60669165-60669187 GTGAATGAATAAATGAGCAAGGG - Intergenic
1176039544 20:63057183-63057205 GTGAATGAATGAATGAAAAAAGG - Intergenic
1177061123 21:16375473-16375495 GTGAACTCATGAATGAACAAAGG + Intergenic
1178876824 21:36420331-36420353 ATGAATGAATGAATGAACAAAGG - Intergenic
1180295778 22:10933361-10933383 GTGCAATAAAAAATGATAAAGGG - Intergenic
1180412907 22:12632701-12632723 GTGCAATAAAAAATGATAAAGGG + Intergenic
1182537567 22:31016606-31016628 CTGAATTAAAGAATGGGGAAAGG - Intergenic
1182563245 22:31178410-31178432 GTTAATTAGAGAATCATCTAGGG + Intronic
1184121869 22:42456233-42456255 GTTAATTCAATAATGATTAAGGG + Intergenic
1184704937 22:46204683-46204705 CTCAATTAAAAAATGAGCAAAGG - Intronic
1184757014 22:46522506-46522528 TGGAATTAAAAAATGAGCAAAGG - Intronic
1185357790 22:50385079-50385101 GTGAATTAATGAGTTATCATGGG - Intronic
949197829 3:1334720-1334742 GTGAATTAAAGAATGGTGCTCGG - Intronic
949209484 3:1480756-1480778 ATGCAATAAAAAATGATCAAGGG + Intergenic
949342820 3:3047920-3047942 ATGCAATAAAAAATGATCAAGGG + Intronic
950210423 3:11118983-11119005 AAGAAATAAAGAATGAGCAAAGG - Intergenic
952206922 3:31189537-31189559 ATGAATGAATGAATGATGAATGG + Intergenic
952223871 3:31353452-31353474 ATGAGTAAAAGAATGATCCAAGG - Intergenic
952567520 3:34676834-34676856 GTGACTTAATGAGTGATAAATGG + Intergenic
952705633 3:36374933-36374955 CTGAATAAAACAATGACCAATGG + Intergenic
953152037 3:40333537-40333559 GTGAATTAAAGTTTAATTAAAGG - Intergenic
953833122 3:46319397-46319419 CTGGATTAAAAAATGAGCAAAGG - Intergenic
955052160 3:55423429-55423451 GTGAATGAAAGAGTGAGCCAGGG - Intergenic
955211771 3:56948421-56948443 GTGCAATAAAAAATGATAAAGGG + Intronic
955423273 3:58761384-58761406 GTGCAATAAAAAATGATAAAGGG - Intronic
955438877 3:58934064-58934086 GTGGAATAAAAAATGATAAAGGG + Intronic
955719279 3:61864552-61864574 GTTTATTAAAGAAAGATCAAGGG - Intronic
955792115 3:62598778-62598800 GTGAATGATGGAATGAGCAAGGG - Intronic
957274279 3:78069992-78070014 TTGAATGAAAGAATGCTTAAAGG + Intergenic
957658928 3:83121105-83121127 CTGAATTAAAGTATGATAAATGG - Intergenic
958068715 3:88580430-88580452 GTGAATTAAACAATGTGTAAAGG - Intergenic
958176219 3:89999253-89999275 ATGAAATAAAAAATGATAAAGGG + Intergenic
958694331 3:97508893-97508915 GGGCATTAAATAATGATAAAGGG - Intronic
960566087 3:119133362-119133384 GTGCAATAAAAAATGATAAAGGG + Intronic
961554305 3:127687752-127687774 GTGAGTGAATGAATGAGCAAGGG - Intergenic
962105673 3:132386240-132386262 ATGAAATAATGAATGAACAAAGG + Intergenic
962128891 3:132651623-132651645 GTGAATGGCAGTATGATCAATGG - Intronic
964792807 3:160469047-160469069 GTGGTTTAAAGAAAAATCAAGGG - Intronic
965690020 3:171345927-171345949 ATGAATGAATGAATGATGAATGG + Intronic
965816985 3:172647033-172647055 CTGAATAAAAGAATAAACAACGG + Intronic
965842164 3:172918721-172918743 GAGACTTCAGGAATGATCAAAGG + Intronic
966041944 3:175502090-175502112 GGGAACTAAAGAATAAACAAGGG + Intronic
966719590 3:183048521-183048543 GGGCATTAAACAATGATAAAAGG + Intronic
966969923 3:185034463-185034485 CAGAATTAAAAAATGAGCAAAGG - Intronic
967039949 3:185682602-185682624 CTCAATTAGAGAATGAACAAAGG + Intronic
967463527 3:189775648-189775670 GTGAATTAAAGAGAGATAGAAGG - Intronic
967652932 3:192008721-192008743 GTGAAATAAAGAGATATCAAGGG + Intergenic
967759878 3:193211804-193211826 ATGAATTGAATAATTATCAATGG - Intergenic
968914300 4:3490500-3490522 GTGAAGGAAAGAATGAGCAGGGG - Intronic
969206213 4:5648372-5648394 ATGAATTAATGAATGATGGATGG - Intronic
969973910 4:11078044-11078066 GTGCAATAAAAAATGATAAAGGG + Intergenic
970213730 4:13737227-13737249 GTGAATGAATGAATGATGAGTGG - Intergenic
970444657 4:16113615-16113637 ATGACTTAAAAAATAATCAATGG - Intergenic
970798346 4:19942313-19942335 GAGAATTGAAGAATGTTCTATGG - Intergenic
971027647 4:22604309-22604331 GTAATTTAAAAAATGATAAATGG + Intergenic
971414401 4:26410642-26410664 GTGAACTGAATAATCATCAAAGG + Intronic
971706190 4:30046685-30046707 ATGCAATAAAGAATGATAAAGGG - Intergenic
971732983 4:30409534-30409556 GCGAAATGAAGAATGACCAATGG + Intergenic
972312868 4:37897120-37897142 GGGGCTTAAAGAATGGTCAAAGG + Intronic
972463405 4:39328443-39328465 AAGAATTAAAGAGTGATGAAGGG + Intronic
972877360 4:43379427-43379449 CAGAATTAAAGACTAATCAAAGG + Intergenic
972956598 4:44399955-44399977 ATGAATTAAAGAATGGTAGAGGG - Intronic
973160796 4:47013659-47013681 GTCAATAAAAGAATGAACAATGG - Intronic
973681172 4:53321852-53321874 TTGAAAGAAAGAATGAACAAAGG - Intronic
974510505 4:62834408-62834430 GTGAATTAAACAGTGAGAAATGG - Intergenic
975232443 4:71950850-71950872 ATGAAATAAAAAATGATAAAGGG + Intergenic
975236161 4:71999336-71999358 ATGCAATAAAGAATGATAAAGGG + Intergenic
975304912 4:72838386-72838408 ATGAAATAAAAAATGATAAAAGG - Intergenic
975309018 4:72881615-72881637 ATGAAATAAAAAATGATAAAGGG - Intergenic
976153057 4:82112456-82112478 ATGAAATAAAAAATGATAAAAGG + Intergenic
976170610 4:82300382-82300404 ATGAAATAAAAAATGATAAAGGG - Intergenic
976328879 4:83804848-83804870 ATAATTTAAAAAATGATCAAAGG + Intergenic
976759258 4:88530563-88530585 GTGGATTAAAAAATGAGGAAAGG - Intronic
976814824 4:89135659-89135681 GGGAATTAAAGAATGATAAAAGG + Intergenic
977798425 4:101196235-101196257 CTGAATTAAAATATGATCAAGGG + Intronic
977876530 4:102156438-102156460 TTGTATTAAAAAATGACCAATGG + Intergenic
978186596 4:105863390-105863412 ATGCAATAAAGAATGATAAAGGG + Intronic
978193862 4:105947755-105947777 GGAAAATAAAGAATGTTCAAAGG - Intronic
979098582 4:116584955-116584977 TGTAATTAAAGAATAATCAAGGG - Intergenic
979345013 4:119576980-119577002 GTGCAATAAAAAATGATAAAGGG + Intronic
979403998 4:120286588-120286610 GGGAAATAAAGAATAATGAAAGG - Intergenic
979467000 4:121051468-121051490 GTAAATTATAAAATGGTCAATGG + Intronic
980885653 4:138759615-138759637 GAGAATGAAATAATGCTCAAAGG - Intergenic
981076005 4:140593096-140593118 GGGCATTAAATAATGATAAAGGG - Intergenic
981206995 4:142053832-142053854 GTGGATTAGAGAATGGTCACTGG - Intronic
981995041 4:150964848-150964870 ATGAATTTAAAAATGAGCAAAGG + Intronic
982058975 4:151584034-151584056 GTAAATGAATGAATGATTAAAGG + Intronic
982557723 4:156889894-156889916 GTGAATAAAAAAATGTTGAATGG + Intronic
982638280 4:157924491-157924513 ATGCATTAAAAAATGATAAAGGG - Intergenic
982913458 4:161175171-161175193 GTGAATTAATGAATAAATAATGG - Intergenic
982924061 4:161313593-161313615 TTAAATTAAAAAATAATCAATGG - Intergenic
983347086 4:166541005-166541027 ATGAATAAAAGAATTATAAATGG + Intergenic
984123340 4:175773000-175773022 GTTAATTAAATAATCATAAAAGG - Intronic
984681621 4:182616932-182616954 GTGCTTTAGAGAATGATGAAAGG - Intronic
985015899 4:185635713-185635735 GTAAATTAAAGAAACATTAAAGG + Intronic
985439190 4:189966976-189966998 GTGCAATAAAAAATGATAAAGGG + Intergenic
987544716 5:19298880-19298902 ATGAATTAATGATTGAACAACGG - Intergenic
987745078 5:21959952-21959974 GTGCATTACATAATGATGAAGGG + Intronic
987763127 5:22191422-22191444 TTAAATTAATGAATGATAAATGG + Intronic
987825771 5:23028296-23028318 GTGTATTAAACTATGGTCAATGG - Intergenic
988465506 5:31487458-31487480 ATGAATTAAAGAATGAAAAAGGG + Intronic
988881672 5:35510091-35510113 CTTAATTAAAAAATGAGCAAAGG + Intergenic
989222800 5:38987560-38987582 GTGCAATAAAAAATGATAAAGGG - Intronic
989459626 5:41682578-41682600 ATGAATAAACAAATGATCAATGG + Intergenic
989593473 5:43133667-43133689 GAGAATTAAAGAATGTTTAATGG + Intronic
989687733 5:44109015-44109037 ATCAAATAAAGAATGAGCAAGGG - Intergenic
990179477 5:53144354-53144376 ATGCAATAAAAAATGATCAAGGG + Intergenic
991171328 5:63629220-63629242 ATGCAATAAAGAATGATAAAGGG + Intergenic
991634241 5:68687381-68687403 ATGAGTTAAAAAATTATCAAAGG - Intergenic
991897908 5:71424826-71424848 TTAAATTAATGAATGATAAATGG + Intergenic
992031997 5:72730884-72730906 GTGCAATAAAAAATGATAAAGGG + Intergenic
992074306 5:73176786-73176808 CTGAGTGAAAGAATGATAAAAGG - Intergenic
992182214 5:74209481-74209503 ATCAATTAAAAAATGATCAAAGG + Intergenic
992283829 5:75211812-75211834 CTGAATTAAAAAATGAGTAAAGG - Intronic
992303108 5:75405413-75405435 GTGAATTTAGGAGTCATCAAAGG - Intronic
993163274 5:84317403-84317425 ATGAAATAAAAAATGATAAAGGG + Intronic
993669380 5:90741820-90741842 ATGCATTAAATAATGTTCAAGGG + Intronic
993779521 5:92049196-92049218 GGGCATTAAATAATGATAAAAGG - Intergenic
993944674 5:94103422-94103444 GGGCATTAAATAATGATAAAGGG + Intronic
994152487 5:96463813-96463835 GTGAAAGAAAGAAAGATAAAGGG - Intergenic
994586313 5:101713982-101714004 GTGAATTACATAATGGTAAAGGG - Intergenic
994998933 5:107102629-107102651 ATTGATTAAAGAATGATCATGGG + Intergenic
996211008 5:120809963-120809985 CTGAATTAGGGAATCATCAATGG - Intergenic
996402174 5:123074511-123074533 GTGAATGAATGAATGAACAAGGG - Intergenic
996576652 5:124983377-124983399 GTGAATTAATGAATTAACACAGG - Intergenic
997063479 5:130535103-130535125 GTGAATTCAAGAAGCATTAAGGG + Intergenic
997331774 5:133068613-133068635 GAAAATTAAAGAATGATGACTGG + Intronic
997643113 5:135462665-135462687 GTCAATTAAAGACTGAGAAAGGG - Intergenic
998564228 5:143202174-143202196 GTGCATTAAATAATGGTAAAGGG - Intronic
999125509 5:149243120-149243142 GTTTCTTAAAGAATGATCTATGG + Intronic
1000305374 5:159989625-159989647 TTGATTTAAAAAATGAGCAAAGG - Intergenic
1000430901 5:161151027-161151049 GTGAAATAAAGAATGTTTAGGGG - Intergenic
1000684759 5:164234961-164234983 GTTAATTAAAGAATGCTGCAGGG + Intergenic
1001273360 5:170332148-170332170 GTGACTTGAAGAAGGATGAAAGG - Intergenic
1003411694 6:5869623-5869645 GTGAATGAATGAATGAAAAATGG - Intergenic
1005123404 6:22417358-22417380 TTCAATAACAGAATGATCAAAGG - Intergenic
1005533987 6:26736200-26736222 GTGAATTAAAGTTTGTTGAATGG - Intergenic
1005534534 6:26742479-26742501 GTGAATTAAAGTTTGTTGAATGG + Intergenic
1005536808 6:26765454-26765476 GTGAATTAAAGTTTGTTGAATGG + Intergenic
1005797801 6:29386199-29386221 GGGAAGTAAAGAGTGATCCAGGG - Intronic
1007383959 6:41508132-41508154 ATGAATTAAAAACTGAGCAATGG + Intergenic
1008204427 6:48636907-48636929 CTGAGTTAAAGAAAGATAAACGG + Intergenic
1008229503 6:48967348-48967370 GTGAATTAATGAATGAAGATAGG - Intergenic
1008399109 6:51043265-51043287 AAGATTTAAAGAATCATCAAAGG - Intergenic
1008470822 6:51882396-51882418 GTGAAATAAATAATCTTCAATGG + Intronic
1008981655 6:57490310-57490332 GTGAATTTGAGAAGGATGAAGGG - Intronic
1009577687 6:65488023-65488045 ATGAAATAAAAAATGATAAAGGG - Intronic
1009775348 6:68198363-68198385 GTGCATTAAATAATGATAAATGG + Intergenic
1010129335 6:72472714-72472736 GTGCAATAAAAAATGATAAAGGG + Intergenic
1010466743 6:76176208-76176230 GGGAATTACATAATGATAAAGGG + Intergenic
1010594885 6:77751412-77751434 ATGAAATAAAAAATGATAAAGGG + Intronic
1010643246 6:78356334-78356356 TTGAATGAAAGAATGAATAAAGG - Intergenic
1011283198 6:85697634-85697656 GTGCAATAAAAAATGATAAAGGG - Intergenic
1011581094 6:88866235-88866257 GAGAATTATGGAATTATCAAGGG + Intronic
1011903243 6:92327330-92327352 ATGAATTAATGAATGAAGAAAGG - Intergenic
1011958983 6:93062680-93062702 ATAAATTAAAAAATGATTAATGG - Intergenic
1013139760 6:107321203-107321225 ATGAATGAATGAATGAGCAAAGG + Intronic
1013708486 6:112869207-112869229 GGGCATTAAATAATGATAAAGGG + Intergenic
1014555309 6:122838130-122838152 TTGAATTAAAGTGTCATCAAAGG - Intergenic
1015006098 6:128283552-128283574 GTAAATTAAATAATTTTCAATGG + Intronic
1015149593 6:130021537-130021559 GTTAATTAAAAATTGATCAGAGG - Intronic
1015999367 6:139028226-139028248 ATGAAATAATGAATGAACAAGGG + Intergenic
1016491912 6:144614571-144614593 GTAAATGAATGAATGAACAAGGG + Intronic
1016734896 6:147467361-147467383 GGGAATTAAAGACTTACCAAAGG - Intergenic
1017298625 6:152830494-152830516 CTGAAATAAAAAATGATAAATGG - Intergenic
1019939711 7:4279793-4279815 GGAAGTTAAAGAATGATAAAAGG + Intergenic
1020736268 7:11952554-11952576 GTGAATTATTTAATGATGAAGGG + Intergenic
1021382863 7:19989349-19989371 GTTAAGTAAATAATGATGAAAGG - Intergenic
1021569238 7:22047841-22047863 GTGAATTTAAAAAAAATCAAAGG + Intergenic
1022689868 7:32638185-32638207 GTGAGTGAAAGAAGAATCAAAGG + Intergenic
1022917454 7:34972419-34972441 GTGAGTGAAAGAAGAATCAAAGG + Intronic
1023290970 7:38668704-38668726 GTGCAATAAAAAATGATAAAGGG - Intergenic
1024616727 7:51121342-51121364 CTCAATTAAAAAATGAGCAAAGG - Intronic
1024683590 7:51719860-51719882 GTTATTTAAAAAATGAGCAATGG - Intergenic
1025788185 7:64663180-64663202 TTGAAATAAAAAATGATAAAGGG + Intergenic
1027478845 7:78669213-78669235 ATGAAATAAAAAATGATAAAGGG + Intronic
1027732379 7:81891124-81891146 CTGAATTAAAAAATGGGCAAAGG + Intergenic
1027742096 7:82021764-82021786 CTGAAATAGAGAATGATAAAGGG + Intronic
1028112637 7:86960745-86960767 GTTAATTACATAATGATAAAAGG - Intronic
1028484925 7:91347385-91347407 GTGCCTTAAACAATGATCAGAGG - Intergenic
1028768729 7:94590345-94590367 GTGAATGAAAGCATGCTAAATGG - Intronic
1028837043 7:95386274-95386296 GTGCAATAAAAAATGATAAAGGG + Intronic
1029045803 7:97626906-97626928 TTGATTGAAAGACTGATCAAAGG - Intergenic
1031286365 7:119874141-119874163 GTAAATTAAATTATGATCAGAGG - Intergenic
1031784231 7:126008712-126008734 GTAAATAAAATAATCATCAATGG - Intergenic
1032718283 7:134529445-134529467 TTGAATGAAAGAATTATGAAGGG + Intronic
1032967931 7:137123005-137123027 ATGAATGAAAGTATGTTCAAAGG + Intergenic
1033066743 7:138163111-138163133 GTGAATTAAAGTATTATTTAAGG + Intergenic
1033186719 7:139232495-139232517 GGGAATTTAAGAATAATTAAAGG + Intronic
1035695211 8:1590902-1590924 GTGGCTTAAAGAATGGTTAAGGG - Intronic
1037026779 8:14048286-14048308 GTTAAGAAAAGAATGTTCAAAGG + Intergenic
1038903660 8:31872873-31872895 TTGATTTACAGAATGATGAATGG - Intronic
1040008612 8:42642261-42642283 CTAAATTAAAGACTGAGCAATGG - Intergenic
1040099273 8:43483334-43483356 ATGCATTAAAAAATGATAAAGGG + Intergenic
1041156088 8:54988296-54988318 GTGCAATAAAAAATGATAAAGGG + Intergenic
1041629260 8:60066387-60066409 GTGAATAAGAGAATGAACACTGG - Intergenic
1042431169 8:68708101-68708123 GAAAATTAAAGAATTCTCAAGGG - Intronic
1043079087 8:75742373-75742395 GTAAATTAAAGTATGTTCAAGGG - Intergenic
1043352966 8:79382814-79382836 GGGAATAAAAGAATGATTTAAGG - Intergenic
1043736790 8:83758109-83758131 AGGAATTAAAGAATCATCAGAGG + Intergenic
1044155755 8:88844477-88844499 GTGCATGAAAGAATAATAAATGG + Intergenic
1045365993 8:101476701-101476723 GTGATGTTAAGATTGATCAACGG + Intergenic
1046392975 8:113601362-113601384 GTGCATTAATGAATGAATAAAGG - Intronic
1046759291 8:118004581-118004603 GTGATAGAAAGATTGATCAATGG - Intronic
1046792807 8:118340038-118340060 TTGAATAAATGAATGAACAAAGG - Intronic
1047364217 8:124197528-124197550 CTGAATAAATGAATGAACAAAGG + Intergenic
1047703913 8:127478431-127478453 GTGAATAAATGAATGAATAATGG - Intergenic
1048130412 8:131689981-131690003 GTGATTTATAAAATGAGCAAAGG - Intergenic
1048936486 8:139361835-139361857 ATGAAATAAAGAATAAGCAAAGG + Intergenic
1050179786 9:2908908-2908930 CTGAGTTAAAAAAGGATCAAAGG - Intergenic
1050532727 9:6604904-6604926 CTGAATGAATGAATGAGCAATGG - Intronic
1050639134 9:7647236-7647258 GGGCATTAAATAATGATAAAGGG - Intergenic
1050672076 9:8008580-8008602 CTGGATTAAAAAATGAGCAAAGG - Intergenic
1050917296 9:11153410-11153432 GTCCATTAAAAAATGGTCAAAGG - Intergenic
1052317449 9:27130545-27130567 GTCAATTCAAGAATAATAAAAGG + Intronic
1052398723 9:27973770-27973792 GTTACTTTAAGAATAATCAAAGG + Intronic
1055267954 9:74519874-74519896 GTGAATTAAAGAATGATCAACGG - Intronic
1055520634 9:77077294-77077316 GTGAATGGAAGGATCATCAATGG - Intergenic
1056378816 9:86039113-86039135 CTCAATTAAAAAATGAGCAAAGG + Intronic
1058377237 9:104336836-104336858 CTGAAACAAAGAATGATTAATGG - Intergenic
1058573457 9:106373455-106373477 GAGAAATATGGAATGATCAAAGG + Intergenic
1058674723 9:107390527-107390549 ATGAATGAAAGAATGAGTAATGG + Intergenic
1058800489 9:108540518-108540540 ATGAATGAATGAATGAACAAAGG + Intergenic
1059678093 9:116559456-116559478 CTGAATTAAATTATGATCTATGG + Intronic
1060014285 9:120072976-120072998 TTGAATGAATGAATGAACAAAGG - Intergenic
1060057595 9:120428399-120428421 ATGCAATAAAGAATGATAAAGGG + Intronic
1060869535 9:127028664-127028686 TTAAATTAAATAATGCTCAAAGG - Intronic
1186499934 X:10043192-10043214 GTATTTTAGAGAATGATCAAAGG + Intronic
1186782953 X:12931481-12931503 GTGAATGAATGAATGAGCAAAGG + Intergenic
1187370706 X:18703550-18703572 ATGAATGAATGAATGAACAAAGG - Intronic
1188349905 X:29115962-29115984 GCAAATTAAAGAATAATCAATGG + Intronic
1188455025 X:30354432-30354454 GGGAATTACATAATGATAAAGGG - Intergenic
1188487070 X:30693445-30693467 GTGAACTGAAGAAAGATTAATGG - Intronic
1188930233 X:36100303-36100325 GAGAATTAAAGAATGAGTACTGG + Intronic
1188969428 X:36595873-36595895 GTGAAGAAAAGAATGATAAAAGG - Intergenic
1189718406 X:43888526-43888548 CTCAATTAAAAAATGAGCAAAGG - Intergenic
1190399093 X:50013845-50013867 CTGACTGAAAGAATGAACAAAGG - Intronic
1190935162 X:54993228-54993250 GGAAATTTAAGAAAGATCAAGGG - Intronic
1191819737 X:65291929-65291951 GAGCATTAAATAATGATGAAGGG + Intergenic
1192289323 X:69775899-69775921 GTTAATTAAGTAATGATCTATGG - Intronic
1192694973 X:73403761-73403783 GTGCATTACATAATGATAAAGGG + Intergenic
1192931159 X:75807651-75807673 ATGAAATAAAAAATGATAAAGGG - Intergenic
1192933682 X:75836113-75836135 ATGAAATAAAAAATGATAAAGGG - Intergenic
1193060787 X:77204842-77204864 GTGCAATAAAGAATGATAAAGGG - Intergenic
1193228979 X:79020897-79020919 TTTAATAAAAGAATGCTCAATGG + Intergenic
1193315779 X:80063393-80063415 ATGAAATAAAGAATGATAAAGGG - Intergenic
1193398648 X:81015244-81015266 GTGAGTTACAGAAGTATCAAAGG - Intergenic
1193516791 X:82475811-82475833 GTGTATTAAAAAATGGTAAAGGG - Intergenic
1194602791 X:95943431-95943453 CAGAATGAAAGATTGATCAAAGG - Intergenic
1194620994 X:96171660-96171682 GTGAATAAATGTATGATCAAAGG + Intergenic
1195443558 X:104924066-104924088 GGGCATTAAATAATGATAAAGGG + Intronic
1195603906 X:106780301-106780323 TTGTAATAAAGAATGATCATTGG + Intronic
1195741085 X:108065014-108065036 GTGAATGAATGAATTATAAATGG + Intronic
1196167197 X:112548650-112548672 ACGCAATAAAGAATGATCAAGGG - Intergenic
1197844330 X:130784887-130784909 GGGAGTTAAAGAATGAGCTATGG - Intronic
1198609828 X:138385406-138385428 GTGCATTACATAATGATAAAGGG + Intergenic
1198798744 X:140427810-140427832 GTGAATTTAACAATATTCAATGG + Intergenic
1199154242 X:144527391-144527413 GGTAATTAAATAATGATGAAGGG + Intergenic
1200676113 Y:6148465-6148487 ATGCAATAAAAAATGATCAAGGG - Intergenic
1201476575 Y:14388758-14388780 ATGCAATAAAGAATGATAAAGGG - Intergenic
1201524300 Y:14914232-14914254 GTGCAATAAAAAATGATAAAGGG - Intergenic
1201536144 Y:15050536-15050558 ATGCATTAAAAAATGATAAAGGG - Intergenic
1201707441 Y:16952812-16952834 ATGCATTAAAAAATGATAAATGG + Intergenic
1201988016 Y:19990716-19990738 GTGCAATAAAAAATGATAAAGGG - Intergenic
1202337989 Y:23830542-23830564 ATGCATTACTGAATGATCAATGG - Intergenic
1202532777 Y:25839529-25839551 ATGCATTACTGAATGATCAATGG + Intergenic