ID: 1055269208

View in Genome Browser
Species Human (GRCh38)
Location 9:74537191-74537213
Sequence TCATCGTTACCTCTTCCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055269206_1055269208 -10 Left 1055269206 9:74537178-74537200 CCTCCTTCATCATTCATCGTTAC 0: 1
1: 0
2: 0
3: 10
4: 173
Right 1055269208 9:74537191-74537213 TCATCGTTACCTCTTCCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055269208 Original CRISPR TCATCGTTACCTCTTCCCCG TGG Intronic
No off target data available for this crispr