ID: 1055275401

View in Genome Browser
Species Human (GRCh38)
Location 9:74610428-74610450
Sequence AATAACTTTGAACCATTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055275401_1055275402 -1 Left 1055275401 9:74610428-74610450 CCTAGTAATGGTTCAAAGTTATT 0: 1
1: 0
2: 0
3: 12
4: 215
Right 1055275402 9:74610450-74610472 TGAATGTTTATTATGTGCCCAGG No data
1055275401_1055275404 4 Left 1055275401 9:74610428-74610450 CCTAGTAATGGTTCAAAGTTATT 0: 1
1: 0
2: 0
3: 12
4: 215
Right 1055275404 9:74610455-74610477 GTTTATTATGTGCCCAGGGCTGG No data
1055275401_1055275407 21 Left 1055275401 9:74610428-74610450 CCTAGTAATGGTTCAAAGTTATT 0: 1
1: 0
2: 0
3: 12
4: 215
Right 1055275407 9:74610472-74610494 GGCTGGACTGAATGCTTTGCAGG No data
1055275401_1055275403 0 Left 1055275401 9:74610428-74610450 CCTAGTAATGGTTCAAAGTTATT 0: 1
1: 0
2: 0
3: 12
4: 215
Right 1055275403 9:74610451-74610473 GAATGTTTATTATGTGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055275401 Original CRISPR AATAACTTTGAACCATTACT AGG (reversed) Intronic
902832504 1:19026184-19026206 AATAAATTTTAAAAATTACTAGG + Intergenic
902904383 1:19544271-19544293 AATGACTTTCAAAAATTACTAGG + Intergenic
906774463 1:48516627-48516649 AATGACTTTCAAAAATTACTAGG - Intergenic
907644787 1:56231518-56231540 AATGAGTTTTAACCATTAGTGGG + Intergenic
909491393 1:76230504-76230526 AATTACTTTGAAAAAATACTTGG - Intronic
910025194 1:82641989-82642011 AATAACTTTGAAAAACTACCAGG + Intergenic
912610808 1:111041514-111041536 AATAACTTTGAAAAATTGTTTGG - Intergenic
914767983 1:150656329-150656351 AATGACTTTCAAAAATTACTAGG + Intronic
915180008 1:154050224-154050246 AATGACTTTCAAAAATTACTAGG + Intronic
916703331 1:167320938-167320960 AATGACTTTCAAAAATTACTAGG - Intronic
917604661 1:176614408-176614430 AATAACTGTGAACATTTAATAGG - Intronic
919780705 1:201218895-201218917 TACAAGTATGAACCATTACTTGG - Intronic
921191974 1:212718276-212718298 AATAAATTTGAATAATTATTAGG - Intergenic
923715314 1:236420313-236420335 AATAACTTTAAACATTTACATGG + Intronic
1062926911 10:1323654-1323676 ATTACCTTTGTACCTTTACTGGG - Intronic
1064355755 10:14616458-14616480 AATACCTTTTATCCATTTCTTGG - Intronic
1066149521 10:32600687-32600709 AATAATTTTGCACCATTATTGGG - Intronic
1066282254 10:33928855-33928877 TATACCTTTGAAGCATTATTAGG + Intergenic
1066989482 10:42498826-42498848 AATGACTTTCAAAAATTACTAGG + Intergenic
1067133616 10:43588579-43588601 AATGACTTTCAAAAATTACTAGG + Intergenic
1067778889 10:49184010-49184032 AATATGTCTGAACCATTAATGGG - Intronic
1069491464 10:68864890-68864912 AATGACTTTCAAAAATTACTAGG - Intronic
1070232990 10:74591451-74591473 AATATATTTGAACCATGAGTAGG + Intronic
1070345129 10:75534248-75534270 AATACCTTTGAACAGCTACTGGG + Intronic
1077754289 11:5009076-5009098 AAGAGCTTTTAACCATGACTTGG - Intergenic
1080298586 11:30758429-30758451 AATAACCATGAACCTTTACATGG + Intergenic
1081299573 11:41434092-41434114 AATATCTATGGACCATGACTTGG - Intronic
1086426162 11:86684577-86684599 AATAACTTTTAATCATTACAAGG + Intergenic
1086743304 11:90394796-90394818 AATGACTTTCAACATTTACTGGG - Intergenic
1087829468 11:102803339-102803361 AATAACATTTAACCTTTACTGGG + Intergenic
1088467691 11:110159004-110159026 TATAAAATTGAACCATGACTGGG - Intronic
1093929463 12:24940572-24940594 TATAACATATAACCATTACTTGG - Intronic
1094242890 12:28249175-28249197 AATAACTTTAAAGAAATACTGGG + Intronic
1094327153 12:29252854-29252876 AATAACTTTGACCAAATACCTGG - Intronic
1094800766 12:34032093-34032115 AATAACTTTCAACCATTAAGAGG + Intergenic
1095113551 12:38326423-38326445 AATAACTTTCAACCATTAAAAGG + Exonic
1096450562 12:51737537-51737559 AATGACTTTCAAAAATTACTAGG - Intronic
1098354733 12:69601553-69601575 TAAAAATTTGAACAATTACTTGG + Exonic
1098444693 12:70554268-70554290 AATAATTTTGACCCATTTGTGGG - Intronic
1099288839 12:80749690-80749712 AATAACTTTGGAGGATTTCTTGG - Intergenic
1099833845 12:87881218-87881240 AATATTTTTGAACCATAAATGGG + Intergenic
1100873354 12:98936759-98936781 AATGACTATAAAACATTACTGGG - Intronic
1101501242 12:105306152-105306174 AATGACTTTCAAAAATTACTAGG - Intronic
1102330139 12:112022025-112022047 CCTCACTTTGAACCATTACACGG + Intronic
1104454449 12:128899506-128899528 AACAACATACAACCATTACTGGG - Intronic
1104529602 12:129556593-129556615 AATAACTTTGCAATTTTACTTGG + Intronic
1105757936 13:23486860-23486882 AATAACTGTGAATCATTGTTAGG - Intergenic
1106505166 13:30364775-30364797 AATAACTTTGAAGGTTTATTTGG - Intergenic
1106642086 13:31595504-31595526 AATTGCTTTGAATCAGTACTTGG + Intergenic
1107268611 13:38587567-38587589 AATATCTTTGCAACTTTACTTGG + Intergenic
1107391639 13:39970991-39971013 AATAAATTTCAATCTTTACTTGG - Intergenic
1109182200 13:59227036-59227058 AATAACTTAGAACCTGTAGTGGG + Intergenic
1110427188 13:75381611-75381633 AATAACTTTGACTCATATCTGGG - Intronic
1110645023 13:77872786-77872808 AATAAATTTCAAAAATTACTTGG + Intergenic
1110998566 13:82146184-82146206 AATAAATTAGAACAATTAGTAGG + Intergenic
1111001606 13:82191429-82191451 AATAACTTTGGATCATTTCAGGG - Intergenic
1116238390 14:42310556-42310578 AATGACTTTCAAAAATTACTAGG - Intergenic
1116328399 14:43564161-43564183 AAATACTTTTACCCATTACTAGG - Intergenic
1116352340 14:43879400-43879422 AATAACTTCAAACAATCACTTGG + Intergenic
1117082877 14:52169233-52169255 AATGACTTTCAAAAATTACTAGG + Intergenic
1117526857 14:56616990-56617012 AATAAATTTGAACTACAACTTGG - Intronic
1123788789 15:23699007-23699029 AATGACTTTCAAAAATTACTAGG - Intergenic
1127586360 15:60381932-60381954 GATTCCTTTTAACCATTACTTGG + Intronic
1133566216 16:6996290-6996312 AATAACACTGAACTAGTACTGGG + Intronic
1136921946 16:34339919-34339941 AGTAACTTTCAAAAATTACTAGG + Intergenic
1136982627 16:35071887-35071909 AGTAACTTTCAAAAATTACTAGG - Intergenic
1139342906 16:66281282-66281304 AAAACCTTTGAACCAATAGTTGG + Intergenic
1140696029 16:77535173-77535195 AATAAGTTGGAAACATTTCTTGG + Intergenic
1140899317 16:79353434-79353456 AATAACTTTGAATAATTTCTTGG - Intergenic
1144124112 17:12184722-12184744 AATAACTTTTATACATTGCTAGG + Intergenic
1144375943 17:14641630-14641652 AACATCTTTGAACCTTTCCTGGG + Intergenic
1145802597 17:27698429-27698451 AATGACTTTCAAAAATTACTAGG + Intergenic
1146096142 17:29931667-29931689 AAGAACTTTGAACCAATGCATGG + Intronic
1146101694 17:29989098-29989120 AATGACTTTCAAAAATTACTAGG - Intronic
1146761677 17:35484248-35484270 CATAACTTTGTACCTATACTTGG + Intronic
1148287903 17:46412291-46412313 AGTAACAAAGAACCATTACTGGG + Intergenic
1148310072 17:46629871-46629893 AGTAACAAAGAACCATTACTGGG + Intronic
1150037071 17:61813904-61813926 ACTAACTTTAAACAATTCCTTGG - Intronic
1153119821 18:1708323-1708345 AATAATTTTAAAGCATTAGTCGG + Intergenic
1153970587 18:10223300-10223322 AATGACTTTCAAAAATTACTAGG - Intergenic
1155120903 18:22817431-22817453 AATACCTTTGATTCATTATTGGG + Intronic
1155807781 18:30193229-30193251 AAGAACTTTAAAACATTTCTAGG - Intergenic
1158805717 18:60969702-60969724 TTAGACTTTGAACCATTACTGGG - Intergenic
1159661637 18:71103946-71103968 AATGAAGTCGAACCATTACTTGG - Intergenic
1160004372 18:75058791-75058813 TATAACTTTAAACCCTAACTGGG - Intronic
1164031936 19:21415390-21415412 AATGACTTTCAAAAATTACTAGG - Intronic
1164306200 19:24005634-24005656 AATGACTTTCAAAAATTACTAGG - Intergenic
925750755 2:7089203-7089225 TAATACTTTGAAACATTACTTGG - Intergenic
928264513 2:29800382-29800404 AAGGAATGTGAACCATTACTTGG + Intronic
929370123 2:41213071-41213093 AATAAATTAGAAACATTAATGGG - Intergenic
930183529 2:48388034-48388056 AATGACTTTCAAAAATTACTAGG + Intergenic
932188562 2:69719422-69719444 AATAATTTTTAAAAATTACTTGG - Intronic
933046449 2:77543511-77543533 AATAACTTTTTACAATTATTTGG + Intronic
933375516 2:81475539-81475561 AAAAACTCTGAAAAATTACTAGG - Intergenic
935025646 2:99274278-99274300 AATGACTTTCAAAAATTACTAGG - Intronic
935223771 2:101036316-101036338 AATATTTCTGAACCTTTACTGGG + Intronic
940310785 2:152276897-152276919 AATGACTTTCAAAAATTACTAGG - Intergenic
940963979 2:159817610-159817632 AATAACAATGAACCTATACTAGG + Intronic
941315093 2:163982023-163982045 AATAATTTAGAACCTCTACTGGG + Intergenic
941547326 2:166868282-166868304 AATAACGATGAAGCTTTACTAGG - Intergenic
941933630 2:170966126-170966148 CTTAACTTTGAACCATTCTTTGG + Exonic
944680134 2:202069787-202069809 AGAAACTTGGAACCATTCCTTGG + Intergenic
944762251 2:202828325-202828347 AATTACTTTAAACCATTTATTGG + Intronic
947116208 2:226773861-226773883 AGTACTTTTGAACCTTTACTAGG - Intronic
1170282742 20:14669382-14669404 AATCACTCTGAACTTTTACTTGG - Intronic
1171229379 20:23470670-23470692 AATGACTTTCAAAAATTACTAGG + Intergenic
1176675531 21:9773736-9773758 AATAAATTTAAATCATTATTTGG - Intergenic
951394338 3:22147127-22147149 AATAATTTAGAACAAGTACTAGG + Intronic
951571000 3:24063181-24063203 CATGACTTTGAAGCAATACTGGG + Intergenic
951695958 3:25445949-25445971 AATACCTTTAATCCATTACATGG - Intronic
952244850 3:31576154-31576176 AATAACATTTAGCCATTGCTTGG - Intronic
953212815 3:40891389-40891411 AATATTTGTGAACCATGACTGGG - Intergenic
954012024 3:47649457-47649479 AAAAACTAGGAACCATTAGTTGG + Intronic
954232787 3:49230798-49230820 AATGACTTTCAAAAATTACTAGG + Intronic
955391174 3:58523499-58523521 AATAACTATTAACCATCCCTGGG + Intronic
955696058 3:61638105-61638127 AATAACTTTGTACCACGATTTGG - Intronic
957231055 3:77515447-77515469 AATAATTTTAAAATATTACTAGG + Intronic
957294036 3:78312831-78312853 AGAAACTTTGAAACAGTACTTGG + Intergenic
961609816 3:128127688-128127710 AACAACATTTAATCATTACTTGG - Intronic
961859513 3:129903909-129903931 AATGACTTTAAAAAATTACTAGG + Intergenic
963009729 3:140758131-140758153 AATAACTTTCAAACATAACAGGG + Intergenic
963995521 3:151703928-151703950 AATGACTTTCAAAAATTACTAGG + Intergenic
964229126 3:154442246-154442268 AAGGACTTTGAAACATTTCTTGG + Intergenic
964942858 3:162182153-162182175 AATAATGTTGAACACTTACTTGG - Intergenic
965851026 3:173023684-173023706 AAAAACTTTAAAATATTACTGGG - Intronic
966339858 3:178913800-178913822 AATAAGTTTTAACCAATCCTAGG + Intergenic
967468743 3:189838261-189838283 AATAAATTTGAAACATTACCAGG - Intronic
969990659 4:11259244-11259266 AATAAATCTGATCCATGACTCGG + Intergenic
970865257 4:20750869-20750891 TATAACTTTTAACCTTTATTGGG + Intronic
972985512 4:44759314-44759336 AATTACTTTGAATTATTGCTAGG - Intergenic
973008751 4:45045671-45045693 AATGACTTTCAAAAATTACTAGG + Intergenic
973158661 4:46990333-46990355 AATATATGTGAGCCATTACTGGG - Intronic
973514651 4:51530691-51530713 AACAAAGTTGAACCATTGCTTGG + Intergenic
974320727 4:60345842-60345864 ATTAACTTGGAACCCTCACTTGG + Intergenic
974858224 4:67485988-67486010 AATACCTTTGAAACATTTCGGGG - Intronic
975353017 4:73366877-73366899 AATGACTTTTAAAAATTACTAGG + Intergenic
976309297 4:83594458-83594480 GATAACTTTCAAACATTGCTTGG - Intronic
976557250 4:86463678-86463700 AATGACTTTCAAAAATTACTAGG + Intronic
976675693 4:87700331-87700353 AAAAACTATGAAACATTGCTGGG - Intergenic
977016483 4:91698373-91698395 AATGACTTTCAAAAATTACTAGG - Intergenic
977443523 4:97100272-97100294 AATGACTTTCAAAAATTACTAGG - Intergenic
977642230 4:99369812-99369834 AATGACTTTCAAAAATTACTAGG + Intergenic
978168142 4:105633447-105633469 AATAGCTTTGACTGATTACTTGG - Intronic
978958523 4:114645154-114645176 AACAACTTTTAACCAATATTTGG - Intronic
979496502 4:121389612-121389634 AATATCTTTTAAACAATACTTGG + Intergenic
979709605 4:123763304-123763326 AATCACTTTGTACAATTATTTGG + Intergenic
979745876 4:124212358-124212380 AGTACCTTTGAAACATTACTGGG - Intergenic
980550813 4:134332005-134332027 GATTGCTTTCAACCATTACTAGG - Intergenic
980667490 4:135958365-135958387 AATGACTTTCAAAAATTACTAGG - Intergenic
982281873 4:153691744-153691766 AATGACTTTCAAAAATTACTAGG - Intergenic
984060742 4:174986733-174986755 AATGACTTTCAAAAATTACTAGG - Intergenic
984169960 4:176347358-176347380 AATGACTTTCAAAAATTACTAGG + Intergenic
985400012 4:189584961-189584983 AATAAATTTAAATCATTATTTGG + Intergenic
985735820 5:1581768-1581790 AATGACTTTCAAAAATTACTAGG - Intergenic
986384980 5:7224547-7224569 AGTAATATTGAAACATTACTAGG - Intergenic
986642382 5:9884786-9884808 AATAACTTTGACCTTTTTCTAGG + Intergenic
988810946 5:34784898-34784920 AATGACTTTCAAAAATTACTAGG - Intronic
989486175 5:41994860-41994882 AAAAATTTTGCACCATCACTAGG + Intergenic
990306762 5:54501537-54501559 AATGACTTTCAAAAATTACTAGG - Intergenic
990823251 5:59867241-59867263 AGTATCTTTGAACCATTGCCAGG - Intronic
991321608 5:65379786-65379808 AATAACCTTGAAACAAAACTGGG + Intronic
991981658 5:72237899-72237921 AATAACTTTAAAAAATTATTTGG - Intronic
993132102 5:83911926-83911948 AATACCTTTGATCAATTATTGGG + Intergenic
993562970 5:89434770-89434792 AATATCTTTGAATCCTTACCTGG + Intergenic
995711364 5:115039431-115039453 AATGACTTTCAAAAATTACTAGG - Intergenic
996970698 5:129364011-129364033 AATAATTTTGAAACACTTCTTGG + Intergenic
1000820724 5:165979930-165979952 AATAACTTTGATTCAGTACATGG + Intergenic
1002936671 6:1679900-1679922 ATTACCTTTGAACAATTAATTGG + Intronic
1003433690 6:6065942-6065964 AATGACTTTCAAAAATTACTAGG - Intergenic
1004548637 6:16625033-16625055 AAAAACTGTCAACGATTACTGGG + Intronic
1005164116 6:22899539-22899561 TAAAACTTGGAATCATTACTTGG + Intergenic
1005423550 6:25677929-25677951 AATCACTTAAAATCATTACTGGG - Intronic
1005858051 6:29878885-29878907 AATGACTTTCAAAAATTACTAGG - Intergenic
1005871600 6:29977782-29977804 AATATTTTTAAACCATTATTGGG + Intergenic
1006971433 6:38049810-38049832 TAGAAGTTTGAACCACTACTTGG + Intronic
1007087481 6:39159256-39159278 CATAACTTAGAAGCATTAGTGGG + Intergenic
1008783018 6:55130022-55130044 AATGAGTTTGAAACATTAGTAGG - Intronic
1009441356 6:63683051-63683073 AATAACTTTTAAAAATTACTTGG - Intronic
1010579598 6:77578043-77578065 AATATCTTTGAACAATCACATGG + Intergenic
1011424866 6:87215605-87215627 AATAACTTTTAAAACTTACTAGG + Intronic
1013087477 6:106868677-106868699 AAGAACATTGAACCCTCACTGGG - Intergenic
1013475449 6:110502800-110502822 AATGACTTTCAAAAATTACTAGG + Intergenic
1013519498 6:110919690-110919712 AATGACTTTCAAAAATTACTAGG + Intergenic
1014832383 6:126118194-126118216 AATAACATTGAACGATTAAGTGG + Intergenic
1016097032 6:140050712-140050734 AATAATTTAGAACAATTACTGGG - Intergenic
1017220197 6:151957238-151957260 AATATTTTTGAACACTTACTAGG - Intronic
1017933400 6:158980707-158980729 GATAAATTTGAACCATTAAGAGG + Intronic
1018163593 6:161072202-161072224 AATTACTTTAAAACATTTCTGGG + Intronic
1025122835 7:56320005-56320027 AATGACTTTCAAAAATTACTAGG + Intergenic
1026526411 7:71157184-71157206 CATATCTGTGAACCATTTCTTGG + Intronic
1027613425 7:80391158-80391180 AATAACGTTGAATGTTTACTTGG - Intronic
1028216838 7:88143381-88143403 ACTAACTCTGAATCATCACTTGG - Intronic
1028780017 7:94725668-94725690 AATGACTTTCAAAAATTACTAGG - Intergenic
1031646698 7:124235019-124235041 AATAACTTGGAATCAATAATGGG + Intergenic
1033864683 7:145674013-145674035 AACAACTTTGGAGAATTACTTGG - Intergenic
1034580923 7:152041788-152041810 AATGACTTTCAAAAATTACTAGG - Intronic
1036139098 8:6190232-6190254 AATAACTTTAAATCTTTACTTGG - Intergenic
1039730961 8:40276993-40277015 AATAACTATATACCATAACTAGG - Intergenic
1040319072 8:46281650-46281672 AATGACTTTCAAAAATTACTAGG + Intergenic
1040781178 8:51111418-51111440 TATAATTTTGAACCAATAATAGG - Intergenic
1041735155 8:61103168-61103190 AATGACTTTGAGCCAGGACTGGG + Intronic
1041990359 8:63981664-63981686 TATAACTTCAAAACATTACTTGG + Intergenic
1042769016 8:72358526-72358548 AATAACTTTGAACAACTTCTAGG - Intergenic
1043024281 8:75046717-75046739 AATGACTTTCAAAAATTACTAGG + Intergenic
1044323424 8:90832002-90832024 ACTCACTCTAAACCATTACTGGG + Intronic
1045639423 8:104230969-104230991 AAAAACTTTCAAACATTATTTGG + Intronic
1045774532 8:105786587-105786609 AATAAATGTGAAACATTATTGGG + Intronic
1046261422 8:111773046-111773068 AATAACTATGCACTATGACTTGG - Intergenic
1046393389 8:113607193-113607215 AAAATCTATGAACTATTACTGGG + Intronic
1048425768 8:134322188-134322210 AATAACTTTGCTCCACCACTTGG + Intergenic
1050958608 9:11696983-11697005 AATAAATTTGATTCATTATTTGG - Intergenic
1051979864 9:23000796-23000818 ATTAATTTTGAAACACTACTAGG + Intergenic
1052210530 9:25897703-25897725 GAAAATTTTGAACCATTATTTGG - Intergenic
1055275401 9:74610428-74610450 AATAACTTTGAACCATTACTAGG - Intronic
1055426588 9:76203010-76203032 AATAGCTCTGATCCAATACTTGG + Intronic
1056075290 9:83032109-83032131 ATAAACTTGGCACCATTACTTGG + Intronic
1058476196 9:105336033-105336055 AAATACTTTTAACCAATACTTGG - Intronic
1059402723 9:114080759-114080781 AATAACAATGAATCATTAATAGG + Intergenic
1186381128 X:9060428-9060450 CATTACTTTAAACCATTCCTTGG - Intronic
1186627154 X:11306463-11306485 AATAACACTGAACATTTACTGGG + Intronic
1190103255 X:47539301-47539323 AATAACTTTCAATTATTTCTAGG + Intergenic
1191580533 X:62756104-62756126 AATGACTTTCAAAAATTACTAGG - Intergenic
1192687394 X:73321564-73321586 AATGACTTTCAAAAATTACTAGG - Intergenic
1194226999 X:91273318-91273340 ACCTACTTTGAACCATTCCTTGG - Intergenic
1196502500 X:116401936-116401958 AATAACATTGAAACGTTATTTGG - Intergenic
1196973553 X:121134993-121135015 AATAATTTATAACCAATACTTGG - Intergenic
1199833858 X:151569260-151569282 GATCACTTTGAAACATTCCTGGG + Intronic
1200854460 Y:7922216-7922238 GACAACTTTGAATCTTTACTTGG + Intergenic