ID: 1055275407

View in Genome Browser
Species Human (GRCh38)
Location 9:74610472-74610494
Sequence GGCTGGACTGAATGCTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055275401_1055275407 21 Left 1055275401 9:74610428-74610450 CCTAGTAATGGTTCAAAGTTATT 0: 1
1: 0
2: 0
3: 12
4: 215
Right 1055275407 9:74610472-74610494 GGCTGGACTGAATGCTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055275407 Original CRISPR GGCTGGACTGAATGCTTTGC AGG Intronic
No off target data available for this crispr