ID: 1055275789

View in Genome Browser
Species Human (GRCh38)
Location 9:74613877-74613899
Sequence CTGCATTTACGTTGCTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055275784_1055275789 27 Left 1055275784 9:74613827-74613849 CCATTTGCTTTCTGTTCCTGTGT 0: 1
1: 0
2: 9
3: 92
4: 805
Right 1055275789 9:74613877-74613899 CTGCATTTACGTTGCTTTAAAGG No data
1055275786_1055275789 11 Left 1055275786 9:74613843-74613865 CCTGTGTTAATTCACTTCGGATA 0: 1
1: 120
2: 384
3: 1132
4: 4134
Right 1055275789 9:74613877-74613899 CTGCATTTACGTTGCTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055275789 Original CRISPR CTGCATTTACGTTGCTTTAA AGG Intronic
No off target data available for this crispr