ID: 1055278086

View in Genome Browser
Species Human (GRCh38)
Location 9:74642209-74642231
Sequence CTGTGGGCATAAACCAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055278082_1055278086 -1 Left 1055278082 9:74642187-74642209 CCTGGCTTAGATTTATTTCTCAC 0: 1
1: 0
2: 0
3: 20
4: 247
Right 1055278086 9:74642209-74642231 CTGTGGGCATAAACCAGGACAGG 0: 1
1: 0
2: 0
3: 12
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055278086 Original CRISPR CTGTGGGCATAAACCAGGAC AGG Intronic
900299550 1:1969930-1969952 CTTCGGGCAAAACCCAGGACAGG + Intronic
900416446 1:2537363-2537385 CTGTGGGGAAAAACCCTGACAGG + Intergenic
902975608 1:20086020-20086042 CAGTGGGCCTAAAGCAGGGCTGG + Intronic
905036881 1:34924425-34924447 CAGTGGGCAGAACACAGGACAGG + Intronic
907710255 1:56874282-56874304 GTGTGGGTATGAACCAGGCCTGG - Intronic
908246538 1:62231724-62231746 CAGTGGGTATAAAGCAGGAAGGG - Intergenic
908739084 1:67308350-67308372 CTGTGGGCCTGAACCAAGGCTGG - Intronic
909059806 1:70867051-70867073 GTGTGGTGGTAAACCAGGACTGG - Intronic
913349305 1:117840759-117840781 CTGTGGTCCTCAACCAGGAAAGG + Intergenic
919365064 1:196649972-196649994 CTGTGGCCCTAAATGAGGACAGG + Intergenic
920048119 1:203146733-203146755 CTGTGGGCACGAGCCAGGCCCGG + Intronic
920733842 1:208513224-208513246 CTGTGGGCATACAACAGGTTGGG - Intergenic
922616703 1:226965135-226965157 CTGTGGGCATGACCCAGGGATGG - Exonic
1066595475 10:37045032-37045054 CTTTGGGTATATACCAGGAATGG + Intergenic
1070348533 10:75569110-75569132 TTGTGGGCATATGCCAGGAGAGG - Intronic
1071074268 10:81732527-81732549 CTGTGGGCACAAGCCGGGAGTGG - Intergenic
1071255357 10:83867453-83867475 CTGTGAGGATAAAACATGACTGG + Intergenic
1072400375 10:95092559-95092581 CTGTAGGCAGAAAGGAGGACAGG - Intergenic
1073073534 10:100809429-100809451 CTGTGGGCTTCAACCTGGAAAGG + Intronic
1075718276 10:124569625-124569647 CTGTGGCCCTGAACCAGGGCTGG + Intronic
1079354627 11:19719958-19719980 CTGAGGGCCTAGCCCAGGACAGG + Intronic
1079888185 11:26015960-26015982 CTGTGGACAAAGACCTGGACAGG - Intergenic
1081164007 11:39786158-39786180 CTTTGGGCACAAACAAGCACAGG - Intergenic
1083273076 11:61581572-61581594 GTGTGTGCAAAAACCAGGAGTGG + Intergenic
1083496266 11:63056970-63056992 CTTTGGGCATATACCAGTAATGG + Intergenic
1084053427 11:66616181-66616203 CTGGCGGGAGAAACCAGGACAGG - Intergenic
1091188583 11:133669861-133669883 CTGTGGGCAGACAGCAGGGCGGG - Intergenic
1094436369 12:30424948-30424970 CTGTGGCCCTAAATAAGGACAGG + Intergenic
1094854838 12:34398337-34398359 CCGTGGGCATGAACCAGGTATGG - Intergenic
1096711991 12:53464386-53464408 CTGTGGGAACAATCCATGACAGG - Intronic
1097446538 12:59678882-59678904 CTTTGGGCATCAACAAGCACAGG - Intronic
1099834487 12:87891055-87891077 TTGTGAGCATGAACCAGGACAGG + Intergenic
1100281385 12:93121324-93121346 CTGGGGGCATAAACATGGAATGG - Intergenic
1101795014 12:107965009-107965031 CTGTGGTCCCAAACCAGGACTGG + Intergenic
1103409050 12:120697753-120697775 CTCTAGGCATAAACCAAAACTGG - Exonic
1106761887 13:32875785-32875807 CTGTGGGCTTCACCCAGGGCAGG - Intergenic
1107260477 13:38484653-38484675 CTTTGGGTATATACCAGGAGTGG + Intergenic
1111259360 13:85715839-85715861 CTGTGGTAATAAACCAGGTCTGG + Intergenic
1111473528 13:88717882-88717904 CTGTGGCCCTAAATAAGGACAGG + Intergenic
1112328586 13:98460176-98460198 GAGTGGGCATCACCCAGGACAGG + Intronic
1116356703 14:43939045-43939067 CTTTGGGCACCAACCAGCACTGG + Intergenic
1116786950 14:49298046-49298068 CTGTGGGGAAAACCAAGGACAGG - Intergenic
1118136112 14:63030113-63030135 CTGTGAGGACAAACCAGAACTGG - Intronic
1118589522 14:67391024-67391046 CTCAGGGCATAAAGGAGGACAGG + Intronic
1121308879 14:92924028-92924050 CTGTGGGCAGCAACCAGGGAAGG + Intronic
1122808774 14:104277365-104277387 CTGTGGACAGAAAGCAGGAGTGG + Intergenic
1123165329 14:106320258-106320280 CTGTGGACACCAACCAGGGCAGG + Intergenic
1124600314 15:31128288-31128310 CGGTGGGCACAGCCCAGGACAGG - Intronic
1125372856 15:38997029-38997051 TTGTGGGAATAAACAAGGAGGGG + Intergenic
1128650661 15:69410485-69410507 CTGTGGGGATAAGCCAGTAGAGG + Intergenic
1128911954 15:71523641-71523663 CTGTGGCCTTAGTCCAGGACTGG + Intronic
1130233319 15:82113091-82113113 CTGTGGGAATCAAACAGGATGGG + Intergenic
1132698915 16:1213994-1214016 CAGTGGGCACAACCCTGGACCGG + Intronic
1135862721 16:26071696-26071718 CTGTAGGAATACACCAGGGCTGG + Intronic
1138408363 16:56817351-56817373 CAGTGGGCATGCACCAGGAGAGG - Intronic
1138809265 16:60129637-60129659 CTGTGGCCAGAAACCAGGATTGG + Intergenic
1142182357 16:88677449-88677471 CTGTGGGCAGAAGCCAGCGCAGG - Intergenic
1142665704 17:1462364-1462386 CTGAGGGCACAAACCAGTCCTGG + Intronic
1147050343 17:37789817-37789839 CTGTGCCCATAAGCAAGGACAGG - Intergenic
1147588259 17:41665425-41665447 GTGTAGGCAAATACCAGGACTGG - Intergenic
1147976434 17:44250657-44250679 CTGGGGAGATAAAACAGGACTGG - Intronic
1151566643 17:74902267-74902289 CAGTGGGCATCAGCCAGGCCTGG - Intergenic
1151890261 17:76947350-76947372 CCGTGGCCAGAACCCAGGACTGG + Intronic
1152273495 17:79339810-79339832 TTTTTGGCATAAAACAGGACTGG + Intronic
1152618291 17:81347857-81347879 CTGTGGGCTGCAACCAGGGCTGG - Intergenic
1153853422 18:9119531-9119553 CTTTGGGCTAAATCCAGGACTGG - Exonic
1156502940 18:37571156-37571178 CTGTGGGCTCACAACAGGACAGG - Intergenic
1156879935 18:42064927-42064949 CTGTGGGCAGGAACAAGGAAGGG - Intronic
1159035486 18:63273690-63273712 CTTTGATCATAAACCATGACCGG - Intronic
1164228179 19:23264527-23264549 CTGTGGGCATGGACCAGGCAGGG + Intergenic
1164823814 19:31269486-31269508 CTGTGTCCAGAAACCAGGGCTGG - Intergenic
1165771083 19:38380726-38380748 GTGTGCGCATAAACCAGCAAGGG + Intronic
1167975710 19:53224458-53224480 CTTTGGGCTAAATCCAGGACTGG + Intergenic
925749711 2:7076840-7076862 CTGCTGTCATAAACCATGACTGG - Intergenic
931284500 2:60820697-60820719 CTGTGGCCCTAAACGAGGACAGG - Intergenic
931430203 2:62203188-62203210 CTGAGGGCTCAAACCAGGGCAGG + Intronic
932744261 2:74318843-74318865 CTTTGGGCATATACCAGCAGTGG - Intronic
937291717 2:120785877-120785899 CTGTGGTTATAAACCAGGTAAGG + Intronic
937447525 2:121971424-121971446 CAGTGGGCATAAGTCAGCACAGG - Intergenic
937558784 2:123194389-123194411 CTGTGGGCCTAAGCCATTACTGG - Intergenic
938294993 2:130172413-130172435 CGGTGGGCAGGAACCATGACAGG + Exonic
938461635 2:131501423-131501445 CGGTGGGCAGGAACCATGACAGG - Intergenic
938790001 2:134668243-134668265 CTGTGGGCTTGTTCCAGGACAGG - Intronic
939698099 2:145353812-145353834 CTGTTTGCATAAAATAGGACTGG - Intergenic
944146705 2:196514328-196514350 CTTTGGGCACCAACCAGCACAGG + Intronic
945129923 2:206559932-206559954 CTGAGGGTATACAACAGGACAGG - Intronic
945436043 2:209818408-209818430 CTCTGGGTATAATCCAAGACAGG + Intronic
948672953 2:239580163-239580185 CTCTGGGCATTACCCAGAACTGG - Intronic
1170948256 20:20911378-20911400 CTGTGGCCCTAAATGAGGACAGG + Intergenic
1172881335 20:38201723-38201745 TTGTTAGCATTAACCAGGACTGG + Intergenic
1173349271 20:42230227-42230249 CTGTGGACAGAAACCAGCCCAGG + Intronic
1173991851 20:47309702-47309724 CTGTGGGCATGGCCCAGGAGGGG + Intronic
1179049674 21:37878550-37878572 CTATGGCAAGAAACCAGGACTGG + Intronic
1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG + Intronic
1181759821 22:25050535-25050557 CTGTGGCCATAAAACTGGAAGGG - Intronic
1184273344 22:43397086-43397108 CTGGGGGCAAACACCAGGCCTGG + Intergenic
1185109450 22:48892966-48892988 CTGTGGGCAGCACCCAGAACCGG + Intergenic
1185137264 22:49080023-49080045 GTGGGGGCAGAAACCTGGACAGG + Intergenic
951804624 3:26630891-26630913 CAGTAGGTATAAATCAGGACAGG + Intronic
954027881 3:47797463-47797485 CTATGGGCATGCACCAGGTCTGG - Intergenic
955010671 3:55011383-55011405 CTGAGGACATAAACCTGGATGGG + Intronic
956490153 3:69762699-69762721 CTGTCGAGATAAACCAGGGCAGG - Intronic
956643758 3:71436684-71436706 CTGTAGTCATAAACCAAGTCTGG + Intronic
959376476 3:105594049-105594071 CTGTGGCCCTAAATGAGGACTGG - Intergenic
960115753 3:113890347-113890369 CTGTGAGCATCACCCAGGCCAGG - Intronic
960247043 3:115411375-115411397 CTGTGGGCAAGAACCAGGGAAGG + Intergenic
960381834 3:116971878-116971900 TTGTATGCATAAACCAGGTCGGG + Intronic
964969027 3:162537105-162537127 CTGTGGCCATGGACCAGGTCTGG - Intergenic
967388038 3:188929514-188929536 CTCTGGGCACAAACTTGGACTGG - Intergenic
967558351 3:190887130-190887152 CTGTGGGCAGAAACCAACAAGGG + Intronic
967843161 3:194023335-194023357 CTGTTAGCATAAACCAGACCAGG + Intergenic
969762346 4:9197808-9197830 CTGTTGGGACAAACCAGGATTGG + Intergenic
970988966 4:22191175-22191197 CTGTGGCCCTAAAGGAGGACAGG + Intergenic
975914626 4:79309621-79309643 CTATTGGCATAAAACAGCACTGG + Intronic
976584204 4:86776928-86776950 CTCTGGGAATGAGCCAGGACTGG - Intronic
982811013 4:159826003-159826025 CTGTGGGTATGAACCAGCACTGG + Intergenic
984627464 4:182023557-182023579 CTGCTGTCATAAACCAGGAGGGG - Intergenic
985112611 4:186561614-186561636 CTGTGGGCACAAACATGGAGAGG - Intergenic
985658824 5:1145487-1145509 CTGTGGGCAGATTCCAGGAAGGG - Intergenic
990942914 5:61221511-61221533 CTCTGGGCATAAACAAGGGCAGG - Intergenic
992204172 5:74414257-74414279 CTTTGGCCTTAAACCAGGATTGG - Intergenic
992599106 5:78379172-78379194 CTGTGGCCTTAAACAAGGTCAGG - Intronic
992911677 5:81401347-81401369 GGGTGGGCATAAACCAGGGCTGG - Intergenic
995566065 5:113433976-113433998 CTGTGGCCATCAACAAGGAGGGG - Exonic
995810302 5:116099445-116099467 CTTTGCGTATAAACCAGGAGTGG + Intronic
998520423 5:142795183-142795205 CAATGGGCAACAACCAGGACTGG - Intronic
1002168196 5:177360991-177361013 CTGTGGGCAAACACAGGGACAGG + Intronic
1004799860 6:19134558-19134580 CTGTGGACCTAAATGAGGACAGG + Intergenic
1011907611 6:92392025-92392047 CTGTGGCCCTAAATAAGGACAGG + Intergenic
1012565866 6:100650354-100650376 CTATGCTCATAAAACAGGACTGG - Intronic
1016510554 6:144838145-144838167 CTGTGGGCATCAACCAGCCATGG - Intronic
1019730512 7:2627150-2627172 TTGTGAGCAAAAACCAGGCCTGG - Intergenic
1020237510 7:6367722-6367744 CTGTGGCCATAAACCCGCACAGG - Intergenic
1028948005 7:96602541-96602563 GCATGGGCATATACCAGGACTGG - Intronic
1034473884 7:151271464-151271486 CTGTGGGGAAAGACCAGGACTGG + Intronic
1034833143 7:154327309-154327331 CAATTGCCATAAACCAGGACTGG - Intronic
1035573636 8:690331-690353 CTGTGCCCAAAAGCCAGGACAGG - Intronic
1037443077 8:18937297-18937319 CAGTGGGTAGAAACCAGTACCGG - Intronic
1039929526 8:41971922-41971944 CTGTGGGCCTAAGCAAGTACAGG + Intronic
1041311578 8:56522883-56522905 CTGCAGGCATACACCATGACTGG - Intergenic
1042386128 8:68177014-68177036 CTTTGGGCTAAATCCAGGACTGG - Intronic
1048197214 8:132341644-132341666 CTGTGGGCTTAATCCAGACCTGG + Intronic
1048329745 8:133463610-133463632 CTGTGGGCAGAAACCCGGCTGGG - Intronic
1049685056 8:143936056-143936078 CTGTGGGCACAGAGCAGGCCTGG - Intronic
1050789092 9:9443463-9443485 CTGTTGGCCTAAACCATTACAGG - Intronic
1051376271 9:16405622-16405644 CTGTGAGCATAAACGGGGAGGGG - Intergenic
1055278086 9:74642209-74642231 CTGTGGGCATAAACCAGGACAGG + Intronic
1057023758 9:91720561-91720583 GTGTGGGTATGAACAAGGACAGG + Intronic
1059373584 9:113863645-113863667 CAATAGGCATAAACCAGAACTGG + Intergenic
1060206588 9:121686089-121686111 CAGTGGGCAGAGACCAAGACTGG + Intronic
1061273443 9:129556891-129556913 CGCTGGGCAGAAACCAGGAGAGG + Intergenic
1062177316 9:135171006-135171028 CTGGGAGCAGAAACCAGGGCAGG + Intergenic
1188107501 X:26161745-26161767 ATGTGGGTATAAACCGGGACTGG - Intergenic
1188110899 X:26194991-26195013 ATGTGGGTATAAACCGGGACTGG - Exonic
1192831678 X:74756773-74756795 CTTTGGGCATCAGCCAGGATTGG - Intronic
1202268440 Y:23045201-23045223 ATGTGGGCAAAAAACAAGACAGG - Intergenic
1202421432 Y:24678945-24678967 ATGTGGGCAAAAAACAAGACAGG - Intergenic
1202449354 Y:24991137-24991159 ATGTGGGCAAAAAACAAGACAGG + Intergenic