ID: 1055278229

View in Genome Browser
Species Human (GRCh38)
Location 9:74643596-74643618
Sequence TGCCATAAAAATATTGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055278228_1055278229 -1 Left 1055278228 9:74643574-74643596 CCAGTTAATCTCATCAACTAACT 0: 1
1: 0
2: 2
3: 13
4: 99
Right 1055278229 9:74643596-74643618 TGCCATAAAAATATTGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055278229 Original CRISPR TGCCATAAAAATATTGAAGT AGG Intronic
No off target data available for this crispr