ID: 1055285555

View in Genome Browser
Species Human (GRCh38)
Location 9:74724792-74724814
Sequence CTACTGTTCATGAAGACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055285555 Original CRISPR CTACTGTTCATGAAGACAAA TGG Intronic
900382699 1:2392619-2392641 CTACTCTTCATAAAGGGAAAAGG - Intronic
901578096 1:10217278-10217300 CTACTGTTCTTGAACACACCAGG + Intronic
909877090 1:80820727-80820749 CGATTGCTTATGAAGACAAAAGG + Intergenic
910445328 1:87294169-87294191 CTACTCTTCATGAAGAAAAATGG + Intergenic
911165613 1:94721979-94722001 GTTCTATTCATGAATACAAAAGG + Intergenic
911955135 1:104223685-104223707 CTGCTGTTCATCAAAACAGAAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918190384 1:182168394-182168416 CTACTGTACAAGATGAGAAAAGG - Intergenic
919504490 1:198381725-198381747 CTACTCTTTATGAAAACAAATGG + Intergenic
920200500 1:204257217-204257239 CTGCTGGTCCTGCAGACAAACGG + Intronic
920826172 1:209426063-209426085 ATACAGTGCATGAAAACAAAAGG + Intergenic
921031304 1:211337353-211337375 CTGCTGTTCAAGAAGACGCAAGG + Intronic
923054269 1:230413796-230413818 CTCCTGGTGGTGAAGACAAACGG - Intronic
1064211825 10:13366327-13366349 CTGCTGGTCATTCAGACAAATGG - Intergenic
1064513483 10:16120846-16120868 ATAATGTTCAGGAAGCCAAATGG - Intergenic
1066421587 10:35268988-35269010 ATGCTGTTCATGAAGATAATGGG - Intronic
1066428532 10:35331327-35331349 ATACTTTTCAAGAAGAGAAATGG - Intronic
1067901376 10:50244991-50245013 CTTCTGCTCATGAAAAAAAAAGG + Intronic
1068543856 10:58325648-58325670 TTATTGTTAATGAAGAAAAATGG + Intergenic
1071257337 10:83882885-83882907 CTACTCTTCAGGAAGAGAATGGG - Intergenic
1075261035 10:120963962-120963984 CACCTGTCCAAGAAGACAAAGGG + Intergenic
1075267985 10:121021837-121021859 CTACTGGTCAAGAAGTCAAAGGG - Intergenic
1075699434 10:124459622-124459644 CTACTGGCCTTGAATACAAAGGG - Intergenic
1081157222 11:39708363-39708385 TTACTGTTCATGCATTCAAAGGG - Intergenic
1086950620 11:92886985-92887007 TCACTGTCCATGAAGACAAAGGG + Exonic
1086971209 11:93083052-93083074 CTTCTTTTCATGATGACAGATGG + Intergenic
1087539207 11:99493456-99493478 CTACTGCTCATTATGGCAAAAGG - Intronic
1087605088 11:100367098-100367120 CTACAATTCAGGAAGGCAAATGG - Intergenic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1089917153 11:122169048-122169070 CTTCTGTATCTGAAGACAAAAGG - Intergenic
1090833341 11:130435679-130435701 CTCCTGTTCATGAGAACAGAAGG - Intergenic
1091118126 11:133033959-133033981 TTACTGTTTTTGGAGACAAATGG - Intronic
1091492242 12:943256-943278 CTACTCTTCATGAAAACCAAAGG + Intronic
1093242617 12:16696939-16696961 GTTCTATTCATGAAGACAATGGG + Intergenic
1095828082 12:46551272-46551294 CTACTGTTAAAAAAGTCAAAAGG + Intergenic
1095950404 12:47778603-47778625 CTACTTTTCAAGAGGATAAAAGG - Intronic
1097884967 12:64719950-64719972 ATGCTGTTCTTGAAGGCAAAGGG - Intronic
1098066480 12:66622863-66622885 CTACTATTCATGCAGTGAAAGGG + Intronic
1098153579 12:67573448-67573470 CCACTGTGAATGAAAACAAATGG + Intergenic
1098389689 12:69956479-69956501 CTACTTTCCATGAAGATAAATGG + Intronic
1099046660 12:77728922-77728944 CTACTCAGCATGAAGACAATGGG + Intergenic
1099157151 12:79192391-79192413 CTACCCATCCTGAAGACAAAAGG - Intronic
1100467492 12:94859741-94859763 TTATTGTTCATGAAGACAAATGG + Intergenic
1100600947 12:96110923-96110945 CTTCTGCTCATGAAGACTAAGGG + Intergenic
1100603111 12:96129252-96129274 CTACTGTGCATCTAGAGAAAAGG - Intergenic
1100621726 12:96282899-96282921 CTTCTCTTCATGAACACCAAAGG + Intronic
1105652481 13:22394510-22394532 ATACTATTCATGAGGTCAAATGG + Intergenic
1105986121 13:25569275-25569297 CTTCTTATCATGAAGAGAAAAGG - Intronic
1107326267 13:39246451-39246473 ATGCAGTGCATGAAGACAAAGGG + Intergenic
1107416741 13:40208141-40208163 CTACAATACATGAAGACAAATGG - Intergenic
1108924852 13:55729406-55729428 CTACTTCCCAGGAAGACAAAGGG + Intergenic
1109658566 13:65428007-65428029 CTACTATTCATGAAAAAGAAAGG - Intergenic
1111980358 13:95008946-95008968 CAACTGTTGGTGAAGACACAAGG + Intergenic
1112803601 13:103138342-103138364 CTTCTGTTCTTGAAGTCACAAGG - Intergenic
1114961712 14:27899799-27899821 CTGCTGGTTATGAAGACAATTGG - Intergenic
1116596357 14:46852191-46852213 CTATTTTTCATGGAAACAAATGG - Intronic
1116614759 14:47120514-47120536 CTTCTGTTCCTGAAGAAAATAGG - Intronic
1117145684 14:52835152-52835174 ATAAAGTTAATGAAGACAAATGG + Intergenic
1118051302 14:62031497-62031519 CTACTAATCATGAAAACAAGAGG + Intronic
1118700327 14:68426778-68426800 ATACTATTCATCAAGACAATGGG + Intronic
1119895380 14:78215404-78215426 GTCCTGTTCATGAAGACTGATGG - Intergenic
1121556216 14:94839700-94839722 CTACTGATGATGAAGACCAGAGG - Intergenic
1122305299 14:100762172-100762194 ATACTCTTCATCAAGAGAAAGGG + Intergenic
1123111479 14:105869580-105869602 CAACTGTTCTTGAAGAAAAAAGG - Intergenic
1124161851 15:27277765-27277787 CTACTGTTCAACAATAAAAAAGG + Intronic
1124853568 15:33364754-33364776 CTAACGTTCATCAAAACAAAAGG + Intronic
1125275242 15:37981965-37981987 CTACTGTTCATGAGGGAAACAGG - Intergenic
1125789332 15:42351460-42351482 CTTCTGTTTATAAAAACAAATGG - Intronic
1127646324 15:60962929-60962951 CTATTTTTCATGACCACAAATGG - Intronic
1127710219 15:61589743-61589765 CTACTGTTTCATAAGACAAAAGG + Intergenic
1135720676 16:24815191-24815213 CTGCTGTTCATAAAGTCATAGGG - Exonic
1136650188 16:31662436-31662458 CAACTGTTCATGAGGGTAAAGGG - Intergenic
1141174282 16:81709047-81709069 CAACTGTTCATAAAGAAAAGTGG + Intronic
1141729886 16:85814931-85814953 CTAGAATACATGAAGACAAAAGG - Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1144334912 17:14259856-14259878 CTACTGTTAATAAAGACACAAGG + Intergenic
1144521593 17:15956165-15956187 TTACTTTTGATGAAGACTAAGGG + Intronic
1144696113 17:17304916-17304938 CTGGTGTTGATGGAGACAAACGG - Intronic
1146079459 17:29764546-29764568 CTACTCTACATGAAGTCAGAAGG + Intronic
1146767972 17:35540984-35541006 CTGCTGTTCATGAAACCAATTGG + Intergenic
1150844011 17:68636675-68636697 CTAATGTTCTTGAAGCCAAGTGG + Intergenic
1152487725 17:80605557-80605579 CTAGTGATCATCAACACAAATGG + Intronic
1156522386 18:37732766-37732788 CTACTCTTCACAAAGTCAAATGG + Intergenic
1157124487 18:44943172-44943194 CTCCTGTTCATGAGCATAAATGG + Intronic
1158279746 18:55811130-55811152 CTAATTTTTATGAAGTCAAATGG + Intergenic
1163084560 19:14969995-14970017 CTACTCAACATGAAGACAAAGGG + Intronic
1168274629 19:55270562-55270584 CTACTGTTGCTTAAGAAAAAAGG + Intronic
926450801 2:13001292-13001314 ACACTGTGCATGAAGACACATGG - Intergenic
927009230 2:18884881-18884903 CTACTGTTCATTAGCACAATTGG + Intergenic
927350786 2:22111446-22111468 CTACTGTACATTAATACAATTGG - Intergenic
928302326 2:30136860-30136882 TTACTGTACAGGAAGACACATGG - Intergenic
930182271 2:48372684-48372706 ATAATATTCATGAAGTCAAATGG - Intronic
931571933 2:63678452-63678474 CTAATGCACAGGAAGACAAAAGG + Intronic
932161694 2:69466032-69466054 ATACTGCTCTTGGAGACAAATGG + Intronic
936644162 2:114349413-114349435 GTTCTGTTCATCAAGACAATAGG - Intergenic
938580028 2:132637465-132637487 CCTCTGTCCATGAAGACAGACGG - Intronic
939059738 2:137406581-137406603 CAACTGCTCATGAGAACAAATGG - Intronic
939828271 2:147041954-147041976 TTCCTGTCCAAGAAGACAAAGGG - Intergenic
941272282 2:163445238-163445260 CTAAAGTTCATCAAGCCAAAGGG - Intergenic
945765935 2:213977671-213977693 CTACCATTCATGAAAAGAAAGGG - Intronic
946612253 2:221471798-221471820 CCACTGTTCATGGCTACAAAAGG + Intronic
946617422 2:221524829-221524851 CTACTGCTCATGAATTAAAATGG + Intronic
947105280 2:226662348-226662370 CCACTGTTCAGGAAGACAGATGG + Intergenic
948976335 2:241466051-241466073 TTAATGTTCATTAAAACAAAGGG + Intronic
1168927356 20:1593719-1593741 CTACTGTTTACGAAGGAAAAAGG + Intronic
1169637666 20:7710735-7710757 GTACTGTTCTTAGAGACAAAAGG + Intergenic
1170138153 20:13098605-13098627 CTATTTTTCATGAGTACAAAGGG - Intronic
1171805822 20:29679383-29679405 CTAGTGTTCAATAACACAAAAGG + Intergenic
1175291780 20:57880829-57880851 TTCATGTTCATGAAGAAAAAAGG - Intergenic
1177427811 21:20947833-20947855 CTACAGTTCAATAAGACAAAAGG - Intergenic
1177627449 21:23681518-23681540 CTACTGTTCATTCAGAAATATGG + Intergenic
1179008412 21:37534162-37534184 CAAGTTTTCATGAACACAAAGGG - Intergenic
1179640994 21:42747182-42747204 CTGCTGTTGACAAAGACAAAAGG - Intronic
1180645388 22:17334382-17334404 CTCCTGTTGTTGATGACAAACGG - Intergenic
1182658183 22:31906191-31906213 ACACTGTTCCTGAAGAGAAAGGG - Exonic
949715822 3:6930026-6930048 CTAATGTTCAGGCAAACAAAGGG + Intronic
949779962 3:7675240-7675262 GTACTGTTCAAAAACACAAAAGG - Intronic
949793175 3:7816021-7816043 CATCTGTTAATGAGGACAAAAGG - Intergenic
951658305 3:25033903-25033925 CAACTATTCATGAGGAGAAAAGG - Intergenic
956540414 3:70331956-70331978 CTACTGTATGTGCAGACAAAGGG + Intergenic
957343598 3:78932396-78932418 CTACTTTTCAAGAAAATAAAAGG + Intronic
960317661 3:116198190-116198212 CTACTGTTCATAGTGAGAAATGG + Intronic
960358267 3:116679500-116679522 GTGCTGTTCATCAAGACAATGGG + Intronic
962430362 3:135313195-135313217 CTACTCTTCATGAACTCAAGAGG - Intergenic
963525923 3:146413240-146413262 GTACTGTTCATCAAGACAATGGG - Intronic
964437192 3:156666282-156666304 GTACTGTTGATGAGGTCAAAGGG - Intergenic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
966514637 3:180805097-180805119 CTTCTTTCCAAGAAGACAAAGGG - Intronic
967553159 3:190823565-190823587 CTACTCAACATGAAGACAAGAGG - Intergenic
967779665 3:193422233-193422255 CAAATGTTAATGAACACAAAAGG + Intronic
967815437 3:193794433-193794455 CAAATGTTCAGGAAGAGAAATGG + Intergenic
967920824 3:194613009-194613031 AAACTTTTGATGAAGACAAATGG + Intronic
971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG + Intergenic
975621039 4:76296802-76296824 GTACTGTTCAACTAGACAAAAGG + Intronic
977134763 4:93290063-93290085 ATATTCTTTATGAAGACAAAAGG - Intronic
978423753 4:108561115-108561137 ATATTATTCATGAAGACTAATGG - Intergenic
981036200 4:140171548-140171570 CTAATGTTCATGAAAGCAGAAGG - Intergenic
981405009 4:144357635-144357657 AGACTGTTCATGGACACAAAAGG - Intergenic
981646582 4:147005215-147005237 ATACTATTCATGAAGACATTGGG + Intergenic
981867484 4:149441523-149441545 CTACTTTTCATGAAAAAAGAAGG - Intergenic
982295572 4:153825066-153825088 AAACTGTGCATGAAGACTAAAGG - Intergenic
982336463 4:154244701-154244723 CTACTATTCATGAAGAACACAGG + Intronic
984394465 4:179177055-179177077 CAACTGTTGATGAACACAAGCGG + Intergenic
984988494 4:185354354-185354376 CTACTGCTCAAGAGGAAAAAAGG - Intronic
989147455 5:38262823-38262845 CTTCTGTTTATCAAGAGAAATGG - Intronic
990260647 5:54018265-54018287 ATACTGTTGAAAAAGACAAAAGG - Intronic
990855670 5:60264239-60264261 CAAATGTTCATGAAAATAAAGGG + Intronic
991007638 5:61845691-61845713 ATGCTGTTCATCAAGACAATGGG + Intergenic
991696857 5:69281081-69281103 CTGCTGTGTATGAAAACAAATGG - Exonic
993023379 5:82618631-82618653 GTGCTGTTCATCAAGACAATGGG - Intergenic
993101834 5:83550262-83550284 CTCCTGTTCATGAACATAGAAGG - Intronic
996392664 5:122979118-122979140 CCTCTGTTCATGAGGGCAAATGG - Intronic
996588369 5:125117532-125117554 CTACTGTTCTTGAAGATCATTGG - Intergenic
996602685 5:125284283-125284305 CTATTTTTCAGGAAGAAAAATGG + Intergenic
997177238 5:131792135-131792157 CTGCTGTTCATGATGATAACTGG + Intronic
1000582766 5:163054262-163054284 CTAGTGTTCAGGAACACAACAGG + Intergenic
1001021359 5:168185196-168185218 CTCCTAATAATGAAGACAAAAGG + Intronic
1001925961 5:175637399-175637421 CTCCTGTTCACTAAGGCAAAAGG + Intergenic
1002158222 5:177299561-177299583 CTACTGCTTATGAAGATTAAGGG + Exonic
1003374693 6:5565023-5565045 GTCCTGTTGATGAAGAAAAATGG + Intronic
1003716028 6:8646976-8646998 CTACTGTTTAAAAAGACCAAAGG - Intergenic
1003859920 6:10313299-10313321 TTTCTGTGCATGAAGAGAAAAGG - Intergenic
1004401163 6:15289937-15289959 CTTCTTTCCATGAAGACAAGTGG - Intronic
1005085576 6:22003182-22003204 TTACAGTTCATGATAACAAAGGG + Intergenic
1010444580 6:75935826-75935848 CTAATAGTCATGAAGGCAAAGGG + Intronic
1012964370 6:105657483-105657505 GTGCTATTCATCAAGACAAAGGG + Intergenic
1013298562 6:108781640-108781662 CCACTGTTTATGGAGCCAAAGGG - Intergenic
1014042286 6:116842540-116842562 TTACTGTCTTTGAAGACAAATGG - Intergenic
1014816578 6:125942313-125942335 CTTCTGGTGAGGAAGACAAACGG + Intergenic
1015439479 6:133231819-133231841 CTTCTGTTCTTGTAGACAGAGGG + Intergenic
1017176140 6:151506421-151506443 CTTCTATTCGTGAAGGCAAATGG + Intronic
1017581324 6:155867577-155867599 CTACAGTTTATGAAGAAAAGTGG - Intergenic
1018785361 6:167103796-167103818 CTGCTGTTCATAAAGCCACATGG + Intergenic
1018994842 6:168702867-168702889 CTCCTGAACATGAGGACAAAAGG + Intergenic
1019941541 7:4295868-4295890 CTTCTGTTCAAGAAAACCAATGG - Intergenic
1020077834 7:5270245-5270267 ATGAAGTTCATGAAGACAAACGG - Intergenic
1023116657 7:36869330-36869352 ATACTGTTCAGGAAGGCAGAGGG - Intronic
1024689202 7:51780865-51780887 CAGCTGTCCCTGAAGACAAAAGG + Intergenic
1025607128 7:63047446-63047468 CTAGTGTGCATGAAAAGAAAAGG + Intergenic
1027435257 7:78157862-78157884 CAGCTTTTCATGAAGAAAAAGGG + Intronic
1027699238 7:81449456-81449478 ATACTGGTAGTGAAGACAAAGGG + Intergenic
1028011160 7:85646769-85646791 CTCCTATTCATGAAGATAGACGG - Intergenic
1029000443 7:97148866-97148888 TTACTGTACATGGAGACAATAGG - Intronic
1029864141 7:103607282-103607304 CTAATGTTAATTAAGAGAAAAGG + Intronic
1031406949 7:121396748-121396770 CTAGGGTTCAAGAAGTCAAACGG - Intergenic
1032413663 7:131719578-131719600 CTACTGCTGATGCAGACAGATGG + Intergenic
1033188932 7:139258170-139258192 CTACTATTCTTAATGACAAATGG - Intronic
1034330108 7:150275376-150275398 TTACAGTTCATGAAAATAAAAGG + Intronic
1034416436 7:150966974-150966996 CTAAAGTTTATGAAGAAAAAGGG + Intronic
1034667949 7:152834484-152834506 TTACAGTTCATGAAAATAAAAGG - Intronic
1038242434 8:25822346-25822368 CTGCTGTTCATGAAAACCATGGG - Intergenic
1039899190 8:41738816-41738838 CCACTTTTCTTGAAGCCAAATGG + Intronic
1042738948 8:72021394-72021416 CTCCTGATCATAAAGACAAGGGG - Exonic
1043225558 8:77724940-77724962 CTACCGTTGATGGGGACAAATGG + Intergenic
1043629105 8:82305958-82305980 CAGCAGTTGATGAAGACAAATGG + Intergenic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1044184633 8:89236812-89236834 CTGCTGTTCATACAGCCAAACGG - Intergenic
1044210976 8:89550932-89550954 TTACTCTTCATAAAAACAAAAGG - Intergenic
1045499889 8:102737161-102737183 TTACTGTTCTGGAGGACAAAAGG + Intergenic
1046124790 8:109892196-109892218 CTACTTGTCCTGCAGACAAAAGG - Intergenic
1050302987 9:4277625-4277647 CTGCTGTCCTTGGAGACAAAGGG - Intronic
1050349964 9:4731867-4731889 CTACTTGACATGAAGACAATGGG + Intronic
1051897894 9:22007469-22007491 ATAATGTTCATGTACACAAATGG - Intronic
1055285555 9:74724792-74724814 CTACTGTTCATGAAGACAAATGG + Intronic
1055808592 9:80125051-80125073 CTACAGTTCAAGAAGACATTTGG - Intergenic
1056248507 9:84723148-84723170 CTAATGCTCAAGAACACAAAAGG - Intronic
1057581266 9:96289747-96289769 GTCCTGTTCAAGCAGACAAAGGG - Intronic
1058572853 9:106366044-106366066 GTGCTATTCATGAAGACAATGGG - Intergenic
1059453214 9:114383685-114383707 CAAGTGTTCATGAGGATAAAGGG - Intronic
1059463957 9:114453881-114453903 CTATCCTTCATGAACACAAATGG + Intronic
1060917916 9:127402387-127402409 CAACTGTTCATGAAGGCACATGG - Intronic
1185860812 X:3577597-3577619 CTAATGATAATGAAAACAAAAGG - Intergenic
1188171533 X:26933511-26933533 CTACTGTTGAAAAAGACAAAAGG - Intergenic
1188926186 X:36047358-36047380 GTACTTTTCATGATGACAGATGG - Intronic
1189732305 X:44034046-44034068 TTACTCTTCATGAAGTCACAGGG + Intergenic
1189986925 X:46561858-46561880 CTTCTCTTCATGATGACCAAGGG + Intergenic
1190556689 X:51642596-51642618 CTAGTGTACAGGAACACAAAGGG + Intergenic
1194821825 X:98517737-98517759 CTTTTGTTCATAACGACAAAGGG + Intergenic
1194957433 X:100197566-100197588 GTACTATTCATCAAGACAATGGG + Intergenic
1195458792 X:105100368-105100390 CTTCTGTACATGAAGGCTAAGGG + Intronic
1197739640 X:129880006-129880028 CTGGTGTTCAGGAAGGCAAAGGG - Intergenic
1199195151 X:145020506-145020528 AGACTGTTCAGGAATACAAAGGG + Intergenic
1200804145 Y:7415013-7415035 CTAATGATAATGAAAACAAAAGG + Intergenic
1201799234 Y:17936861-17936883 ATACTATTCATCAAAACAAAAGG - Intergenic
1201802319 Y:17969095-17969117 ATACTATTCATCAAAACAAAAGG + Intergenic
1202143549 Y:21754241-21754263 ATACTATTCATCAAGACAAAGGG - Intergenic