ID: 1055295364

View in Genome Browser
Species Human (GRCh38)
Location 9:74827684-74827706
Sequence ACTAGGAGAGTGAGCTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055295356_1055295364 30 Left 1055295356 9:74827631-74827653 CCCATGTGGGAAGGGGGGTGGCT 0: 2
1: 0
2: 0
3: 17
4: 192
Right 1055295364 9:74827684-74827706 ACTAGGAGAGTGAGCTCTGATGG 0: 1
1: 0
2: 2
3: 11
4: 157
1055295357_1055295364 29 Left 1055295357 9:74827632-74827654 CCATGTGGGAAGGGGGGTGGCTG 0: 2
1: 0
2: 0
3: 43
4: 404
Right 1055295364 9:74827684-74827706 ACTAGGAGAGTGAGCTCTGATGG 0: 1
1: 0
2: 2
3: 11
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055295364 Original CRISPR ACTAGGAGAGTGAGCTCTGA TGG Intronic
900731066 1:4260443-4260465 ATTAGGAAAATGAGCTCAGAAGG - Intergenic
903271226 1:22189607-22189629 ACCAGGAGACTGAGGCCTGAGGG - Intergenic
904420147 1:30385938-30385960 CCCAGGAGACTGGGCTCTGATGG + Intergenic
904832274 1:33312672-33312694 ACAAGGAGAGAGAGCTCACAAGG + Intronic
905007024 1:34717962-34717984 ACCAGGAGAGTGAGCTGTGAAGG - Intronic
906832715 1:49050375-49050397 ACTATGAGATTGAGCTCTCCTGG + Intronic
907248561 1:53123105-53123127 AGTCTGACAGTGAGCTCTGAGGG - Intronic
907609586 1:55854810-55854832 GCTAGGAGTCTGAGTTCTGAAGG + Intergenic
908112268 1:60909212-60909234 CCTAGGAGACTGACCTCTGGGGG - Intronic
911229246 1:95343050-95343072 ACTAGGAGACTGAACTGAGAAGG - Intergenic
915444576 1:155967434-155967456 ACTAGCCGTGTGACCTCTGATGG - Intronic
916172639 1:162012204-162012226 ATCAGGAGAGTGAGCCCTGGGGG + Intronic
917603249 1:176598744-176598766 ACTAGAAGAGAGAGCTCTATAGG - Intronic
919830515 1:201537779-201537801 ACTAGAAGTGTGGGCTCTTAAGG - Intergenic
920112551 1:203597593-203597615 TCTAGGAGGCTGAGCTGTGAGGG - Intergenic
920774175 1:208919989-208920011 ACTAGGAGAGTCAGATCACATGG + Intergenic
921157998 1:212453096-212453118 ATTTGGAGAGTGAGCAGTGAGGG - Intergenic
921158004 1:212453136-212453158 ACTAGGAGAGGCAGCTCAGAGGG - Intergenic
923004043 1:230030947-230030969 AATAGGAGCTTGGGCTCTGAGGG - Intergenic
1064280416 10:13946208-13946230 GCTAGGAGAATGAACTCTGCTGG + Intronic
1066223132 10:33355580-33355602 ACTAACTGAGTGAGCACTGAGGG - Intergenic
1067553200 10:47249342-47249364 AGGAGGAGCGTGAGTTCTGATGG + Intergenic
1067568437 10:47354395-47354417 ACCATGTGAGTGAGCGCTGAGGG - Intronic
1069145600 10:64889132-64889154 TCTAGGAGAGGAAGCTCTAATGG - Intergenic
1069254699 10:66318059-66318081 ACAAGGAGATGGGGCTCTGAAGG - Intronic
1069913059 10:71771527-71771549 CCTAGGACAGTGTGCACTGAGGG - Intronic
1070540457 10:77411997-77412019 ACTAAGAGGCTGAGCTCTGCCGG + Intronic
1074170525 10:110930299-110930321 ACTAGGAGTGTGTGGTCTCAAGG - Intronic
1076864857 10:133161503-133161525 CCCAGGGGAGTGGGCTCTGAAGG + Intronic
1078137178 11:8661292-8661314 CCTAGGAGCATGGGCTCTGAAGG - Intronic
1078144592 11:8714214-8714236 ATTCGCAGTGTGAGCTCTGAAGG - Intronic
1080426292 11:32157734-32157756 ACTAGGAGATCCACCTCTGAGGG - Intergenic
1081769242 11:45637268-45637290 GCTAGGACTGTGATCTCTGAAGG + Intergenic
1082818044 11:57523463-57523485 AATAGGTGAGTGAGATTTGAAGG - Intergenic
1089071941 11:115707386-115707408 ACAGGGAGAGTGAGCTCTCCAGG + Intergenic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1090874698 11:130778293-130778315 ACCATGTGAGTGAGCTCAGAGGG + Intergenic
1092020352 12:5197270-5197292 TCAAGGAGAGAGAGCTTTGAGGG - Intergenic
1094034673 12:26055442-26055464 AATAGGTGAGTGAACTCTGTGGG + Exonic
1099347467 12:81520654-81520676 ACAAGGTGACTGAGATCTGAAGG + Intronic
1099437981 12:82666460-82666482 ACTAGGAGAGATGGCTTTGAGGG + Intergenic
1103862880 12:124028343-124028365 ACTGGGACAGCCAGCTCTGACGG - Intronic
1104108942 12:125688155-125688177 TCTAGGAGAGGGACCTCAGAGGG + Intergenic
1111834095 13:93365709-93365731 AGTGGGAAAGTGATCTCTGAAGG + Intronic
1113526375 13:110981050-110981072 ACAAGTGGAGTGAGCTCTGATGG - Intergenic
1115259078 14:31434857-31434879 ACTATGAGAGTGTGGTATGAAGG - Intronic
1115462922 14:33682195-33682217 ACTACCATAGTGATCTCTGATGG + Intronic
1121365309 14:93303727-93303749 ATTTGGAGTGTGAGCTCTGAGGG - Intronic
1122082806 14:99277957-99277979 GCTAGGAAAGAGAGCTCTGGGGG + Intergenic
1123116014 14:105894407-105894429 ACCAGAAGAGTCAGGTCTGAGGG - Intergenic
1124169980 15:27363947-27363969 TCCAGGAGTGTGAGATCTGATGG + Intronic
1124829221 15:33131778-33131800 ACTAGGTAAGTGGCCTCTGAGGG + Intronic
1126373347 15:47970164-47970186 ACTGGGACAATGGGCTCTGAAGG + Intergenic
1127964773 15:63915444-63915466 ACAAGGAGAGTTTGCTCAGATGG + Intronic
1128455791 15:67830622-67830644 AGTAGGAGAGTGACCCCTGGAGG - Intronic
1128649174 15:69397991-69398013 AGCAGGAGAGCGAGCTCTGCAGG + Intronic
1129174946 15:73833094-73833116 ACTGGAAGAGTCAGCCCTGACGG + Intergenic
1129790488 15:78337795-78337817 ACAAGGAGAGTGGGCTCACAAGG + Intergenic
1131088983 15:89605074-89605096 ACTAGGAGAGTATGTCCTGAAGG - Intronic
1135981028 16:27147495-27147517 AGTAGGAAAGAGACCTCTGAAGG + Intergenic
1138182136 16:54948602-54948624 ACAAGGAGAGTGGGGTCAGATGG - Intergenic
1140252611 16:73307388-73307410 ATGAGGATAGTGAGCACTGAAGG + Intergenic
1141676999 16:85523355-85523377 AGTGGGAGAGGGAGCTCTGCTGG - Intergenic
1142645614 17:1312323-1312345 ACTGGGGGAGTGAATTCTGAAGG + Intergenic
1143888872 17:10087149-10087171 ACCAGGAGACTGAGATCTCAGGG + Intronic
1146280726 17:31542433-31542455 GCTATGAGCGTGGGCTCTGAAGG + Intergenic
1146285489 17:31571677-31571699 ACTAGAAGAGTGGGCTCTGAGGG - Intronic
1150517417 17:65828063-65828085 CCTACTAGAATGAGCTCTGAGGG + Intronic
1153520939 18:5953280-5953302 CCTAGAAGAGTGGGCCCTGAGGG + Intergenic
1161184656 19:2908790-2908812 AATAGGAGAGTGATAACTGAAGG - Intronic
1161588751 19:5119276-5119298 ACAGGGAGTGTGAGCTCCGAGGG - Intronic
1163269645 19:16244361-16244383 ACAAGGAAAGTGATCTCAGACGG + Intronic
1163753812 19:19094598-19094620 ACTAGGAGAGTCAGCAGTGGAGG + Intronic
1167528510 19:50000514-50000536 ATGAGGAAACTGAGCTCTGAGGG + Intronic
1167774603 19:51546414-51546436 TCTAGGAGACTGACCTCTGTGGG - Intergenic
925040332 2:727969-727991 ACTCAGAGTGTGAGCTCAGACGG + Intergenic
926027750 2:9559261-9559283 ACTATGTGAGTGAGCTTGGAAGG + Intergenic
926954889 2:18283655-18283677 ACCAGGAGAGGGACCTCTGCAGG - Intronic
927177893 2:20423046-20423068 ACTAGGAGACTGAGGTCAGGAGG - Intergenic
927239998 2:20912984-20913006 ACCAGGTGTGTGTGCTCTGAGGG + Intergenic
929452059 2:42044618-42044640 ACTGGGAGAGAGGGCACTGATGG + Intergenic
929819451 2:45261601-45261623 ACGAGGAGACTGAGCTTGGATGG + Intergenic
930022750 2:47011431-47011453 GCTGGGTGAGTGAGCTGTGAGGG + Exonic
930520835 2:52465082-52465104 AATAGGAGAGTGAGAGCTAAAGG + Intergenic
932536575 2:72603541-72603563 ACCAGGAGGGTCAGCTCTGTTGG - Intronic
935099147 2:99976017-99976039 ACTAGGAAAATGAGCTCTTCTGG - Intronic
935304329 2:101722058-101722080 AGTAGGAGAGAGAAATCTGAAGG + Intronic
935687653 2:105698344-105698366 TCTAGGAGGCTGATCTCTGAGGG + Intergenic
940108856 2:150128487-150128509 AGTAGGAGAGTGAGCAATGTGGG + Intergenic
941835726 2:170018169-170018191 AATAGGAGAGTTAGCACAGAAGG - Intronic
945700955 2:213170324-213170346 AATAGGTGTGTGTGCTCTGAAGG + Intergenic
945973084 2:216249479-216249501 ACTGAGTGAGTGAGATCTGAGGG - Intergenic
947497379 2:230647792-230647814 ACCAAGAGAGTGACCTCTGGTGG + Intergenic
1170704213 20:18730042-18730064 AGTACAAGAGTCAGCTCTGAGGG - Intronic
1174403447 20:50288773-50288795 ACTAGGGGAGTCATCTCTGCTGG - Intergenic
1175072823 20:56349016-56349038 ACTGGGAGTGTGAGTTCTGAAGG - Intergenic
1175526276 20:59636477-59636499 ACCAGGAGTGTGAGCTCAGGTGG - Intronic
1179485440 21:41707217-41707239 AATAGGACAGAGAGCTCTGGAGG - Intergenic
1181148696 22:20867241-20867263 GCTAGGGGAGTGAGCTCCGCAGG - Intronic
1183063149 22:35347575-35347597 ACTGGCAGTGTGGGCTCTGAAGG - Exonic
1183272103 22:36868642-36868664 AATAGGGGAGTGGGCTGTGAAGG + Intronic
1184133443 22:42531648-42531670 ACAAGGAGCGTGAGCATTGAAGG - Intergenic
950212459 3:11134007-11134029 ACCAAGAGAGTGAGCACAGATGG + Intergenic
950696580 3:14705357-14705379 CCTTGGAGGGTGAGCCCTGAGGG + Intronic
952880936 3:37986012-37986034 ACCAGGAGAGGGAGCTGTAATGG - Intergenic
953640970 3:44707483-44707505 ACTACGTGAGTGAGCTCTTTTGG - Intergenic
954709393 3:52497811-52497833 ATTAGGAGTGGAAGCTCTGAGGG + Intronic
958445229 3:94206904-94206926 ATTAAAAGATTGAGCTCTGAAGG + Intergenic
959224910 3:103568118-103568140 ACAAGGCTAGTGAGCCCTGAGGG + Intergenic
959344085 3:105171027-105171049 AAAAAGAGAGAGAGCTCTGAAGG + Intergenic
960746131 3:120890952-120890974 ACTAGGAGAGTGAGCCATAGAGG + Intergenic
961165367 3:124759930-124759952 AATAGGAGAGACAGCTGTGAGGG - Intergenic
961226325 3:125251518-125251540 ATTAGGATAGTGATCACTGATGG - Intronic
962972556 3:140417525-140417547 ACTCGGAGAGTGGGGGCTGAGGG - Intronic
964677362 3:159298614-159298636 ACTAGGACTGAGAGCTCTGCAGG - Intronic
965039493 3:163488382-163488404 ACAAGAAGAGAGAGCTCTGATGG - Intergenic
968381955 4:104057-104079 ACTATGTGTGTGAGCTCTGATGG + Intergenic
968391818 4:199070-199092 ATTATGTGTGTGAGCTCTGATGG + Intergenic
968951623 4:3697879-3697901 ACCAGGAGAGTGACCTCAGAGGG + Intergenic
968961153 4:3744369-3744391 ACCAGCAGAGTGAGCCCAGAGGG + Intergenic
969428134 4:7137850-7137872 ACCTGGAGAGTGGGCTCTGCTGG + Intergenic
971267736 4:25109719-25109741 GCTAGGAGGGTGAGCTCTGGAGG + Intergenic
972557945 4:40199332-40199354 ATTAGGAGAGTTAGCTTTGCAGG - Intronic
972936469 4:44142168-44142190 AAGAGGAGAGGGAGCTCTGTTGG - Intergenic
975632283 4:76416003-76416025 ACTAGGAGCATGACCACTGAAGG - Intronic
976094693 4:81495931-81495953 ACTAGGTGGCTGAGCTGTGATGG + Intronic
979853882 4:125608191-125608213 ACTATCAAAGTGATCTCTGAGGG + Intergenic
982976929 4:162075521-162075543 AGTATGAGAGTCAGCTGTGATGG + Intronic
983224454 4:165072950-165072972 ACCAAGAGAGTGAACGCTGATGG + Intergenic
986865495 5:11981674-11981696 ACTACAAGAATGAGCTCTGAAGG - Intergenic
991489696 5:67170541-67170563 ACTAGGAGAGAGGGCTGTCAGGG - Intergenic
992621416 5:78597121-78597143 CCTAGGAGAGTAAGGTCTGGTGG + Intronic
994152052 5:96458855-96458877 TTTAGGAGGGTGAGATCTGAGGG - Intergenic
1006098616 6:31671716-31671738 GCTAGAAAAGTGAGCTCTGCTGG - Intronic
1006316035 6:33292298-33292320 GCTGGGATAGTCAGCTCTGAAGG + Exonic
1008645852 6:53513817-53513839 ACTCTGAAAATGAGCTCTGATGG - Intronic
1009340849 6:62553151-62553173 TCAGGGAGAGTCAGCTCTGATGG + Intergenic
1011370237 6:86629393-86629415 ACTATGAAAGTGAGCACTCAGGG - Intergenic
1014442624 6:121490845-121490867 ACAAGGATAGTGAGCTCAAATGG - Intergenic
1014678703 6:124400820-124400842 ATTAGGAGAGTGAGCATGGAAGG - Intronic
1015588371 6:134799410-134799432 AATGGGAGAATGAGCTATGAAGG - Intergenic
1022792173 7:33699936-33699958 ACAAGGAGAGAGAGCACTCAAGG + Intergenic
1023039193 7:36157368-36157390 AATAGGAGAGTGAGCAAAGACGG + Intronic
1023204163 7:37730083-37730105 AATAGGAGAGTAGGTTCTGAGGG - Intronic
1023892516 7:44403363-44403385 ACTAGGAGAGTGAGCAGTTGAGG + Intronic
1024534618 7:50419905-50419927 CCTTGCAGAGTCAGCTCTGAAGG - Intergenic
1028154662 7:87416133-87416155 ATGAGGAGAGTGAATTCTGATGG + Intronic
1029092016 7:98055958-98055980 ACAAGGAGAGAGAGCTCCAAAGG - Intergenic
1030693981 7:112564343-112564365 AGTAGAAGAGTCAGCCCTGATGG + Intergenic
1036433706 8:8713497-8713519 AATAGGATAGTGAGCTCCAAAGG - Intergenic
1036659692 8:10700045-10700067 ACTAGGGGCGGGAGGTCTGAGGG - Intronic
1037475699 8:19255299-19255321 ATTAGAAAAGTGAGCTCTCAGGG + Intergenic
1038001107 8:23391929-23391951 ACTTGGGGACTGAGCTCAGAAGG - Intronic
1038523399 8:28252742-28252764 ACATGGAGAGTGAGACCTGAAGG + Intergenic
1038582631 8:28763113-28763135 TCTAGGAGGGTCAGGTCTGATGG + Intergenic
1043022844 8:75026102-75026124 ACAAGGAATGTGAGCTGTGATGG + Intronic
1043127528 8:76418384-76418406 GTTAGGAGCATGAGCTCTGAAGG - Intergenic
1045814658 8:106265748-106265770 ACTAAAAGACTTAGCTCTGATGG - Intergenic
1046588615 8:116178566-116178588 ACTTGGAGAGGAAGCACTGATGG + Intergenic
1047707115 8:127510598-127510620 ACTCTGAGAGTGAGCTGTGTGGG - Intergenic
1049629923 8:143648299-143648321 ATAAGGAGAGTGACTTCTGAAGG + Intronic
1055295261 9:74827130-74827152 ACTAGGGGTGTGAGCTTTGATGG - Intronic
1055295364 9:74827684-74827706 ACTAGGAGAGTGAGCTCTGATGG + Intronic
1055442692 9:76352287-76352309 GCAATGAGAGTGACCTCTGATGG - Intronic
1059551765 9:115236253-115236275 GCTCGGAGGGTCAGCTCTGAGGG - Intronic
1059685119 9:116627626-116627648 ATTAGGAAACTGAGGTCTGAAGG + Intronic
1060471579 9:123952455-123952477 ACAAGGAGGGTGAGCTGTGGGGG - Intergenic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1187738433 X:22328436-22328458 ACTAGAAGAGTGAGGTGTCATGG + Intergenic
1189297012 X:39926030-39926052 ACCAGGAGAGTGTGCACAGAGGG - Intergenic
1200739397 Y:6836947-6836969 ACCAGGAAAGAGGGCTCTGATGG - Intergenic