ID: 1055295380

View in Genome Browser
Species Human (GRCh38)
Location 9:74827811-74827833
Sequence AATGAAGCTCAGAAGGAACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055295380_1055295386 16 Left 1055295380 9:74827811-74827833 CCAGGTTCCTTCTGAGCTTCATT 0: 1
1: 0
2: 0
3: 23
4: 258
Right 1055295386 9:74827850-74827872 CCACGGTCCCATCATCAGACAGG 0: 1
1: 0
2: 0
3: 4
4: 58
1055295380_1055295382 -1 Left 1055295380 9:74827811-74827833 CCAGGTTCCTTCTGAGCTTCATT 0: 1
1: 0
2: 0
3: 23
4: 258
Right 1055295382 9:74827833-74827855 TTCATTTCCATACTTGCCCACGG 0: 1
1: 0
2: 2
3: 13
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055295380 Original CRISPR AATGAAGCTCAGAAGGAACC TGG (reversed) Exonic
902542366 1:17164200-17164222 AATCAAGGCCCGAAGGAACCCGG - Intergenic
903083008 1:20827466-20827488 AATGCACCTCAGAAAGAAACTGG + Intronic
905782344 1:40723253-40723275 TGTGAATCTCAGAAGGCACCCGG + Intronic
906227938 1:44137414-44137436 AATGAAGCTCCAAAGAAACATGG + Intergenic
907987955 1:59551686-59551708 CATGCAGCTCACAAGGAACTGGG - Intronic
909570453 1:77104522-77104544 AATGAAGCACAGAAGAAAAAGGG + Intronic
911730821 1:101290804-101290826 AAGGAAGCAGAGAAGGAATCTGG - Intergenic
913232648 1:116754518-116754540 ATTGAAAATCAGAAGGAAGCTGG - Exonic
913262243 1:117009950-117009972 AATGCTGCTCAGAAGGTCCCTGG - Exonic
916454840 1:164960181-164960203 AATGAAGCTCAGTGGAAAGCAGG + Intergenic
916787515 1:168097177-168097199 CATGAAGATCACAGGGAACCGGG - Exonic
917400218 1:174640209-174640231 AATCAAGATGGGAAGGAACCGGG - Intronic
917521145 1:175749382-175749404 AATGAGGAGCAAAAGGAACCTGG + Intergenic
919121186 1:193342223-193342245 AAAGGAGCTCAGCAGGAGCCAGG - Intergenic
919358011 1:196551096-196551118 AGTGAAGCTCAGAAGTTCCCTGG + Intronic
919464444 1:197912572-197912594 AGAGAACATCAGAAGGAACCTGG - Intronic
919787761 1:201270754-201270776 AATGCAGCTCAGATGGCCCCTGG - Intergenic
921338196 1:214108740-214108762 AATAAAGCAGAGAAGGGACCTGG - Intergenic
922810138 1:228410764-228410786 AGAGAGGCTCAGGAGGAACCAGG + Intronic
924180232 1:241433599-241433621 AAAGAAACTCAGAAAGAACATGG - Intergenic
924327434 1:242909956-242909978 AATGGAGCTCAAAAGGTACATGG - Intergenic
1064869857 10:19925195-19925217 ATTGCAGCTCAGCTGGAACCAGG + Intronic
1066353427 10:34658830-34658852 ATTGAGGCTCAGAATGCACCAGG - Intronic
1067699571 10:48559176-48559198 TTTGTATCTCAGAAGGAACCAGG + Intronic
1067733266 10:48829283-48829305 AATGAAGCTGAGCAGCAACTAGG - Intronic
1068245463 10:54360237-54360259 AATGAAGGTCAATAGGAAGCAGG - Intronic
1069661145 10:70124245-70124267 AATTAAATTCAGAAGGAACAAGG + Intronic
1069721420 10:70551951-70551973 CACGAAGCCCAGAAGGAAACGGG - Intronic
1070061296 10:72985645-72985667 ACAGAAGCTCTGAAAGAACCAGG + Intergenic
1070338911 10:75478978-75479000 AATGAAGCCAAGAAAGAAGCTGG - Intronic
1070447756 10:76524106-76524128 AATAAACATCAGAGGGAACCGGG + Intronic
1071468439 10:85961649-85961671 AAGGAAGCTGAGAAGGAAGGAGG - Intronic
1072942582 10:99780062-99780084 AAGAAATCTCAGCAGGAACCAGG - Intergenic
1074616171 10:115070499-115070521 ACTGAGGCTCAGAAAGAACTTGG - Intergenic
1076249020 10:128970380-128970402 AGTGAAGCTCAGAAAGCAGCAGG + Intergenic
1076810713 10:132885013-132885035 ACAGAAGCTCAGCAGGGACCTGG - Intronic
1083205284 11:61145200-61145222 AATGAATCCCAGAAAGAAGCAGG + Intronic
1083273931 11:61586478-61586500 AATGAGGCTCAGAAGGACTGAGG - Intergenic
1083479039 11:62932015-62932037 AACGAGGCTCAGGAGGAAGCAGG - Intergenic
1084445991 11:69204121-69204143 ACTGAGGCCCAGAAGGAGCCAGG + Intergenic
1085634151 11:78145164-78145186 AATGAAACTCAGAAAGAAACAGG + Intergenic
1087259831 11:95998785-95998807 AAGTAAGCTCACAAGGAAGCTGG + Intronic
1087566436 11:99865171-99865193 ATTGAAGCACAGAAGGAAGGAGG - Intronic
1088785926 11:113181760-113181782 ACTGGACCTCAGAAGCAACCAGG + Intronic
1090046534 11:123340243-123340265 AACAAAGCTCAGCAGGAAGCAGG - Intergenic
1090319152 11:125826935-125826957 AATGAAGCAAAGAAAAAACCAGG - Intergenic
1091157160 11:133384632-133384654 AATGAGGCACAGAAGGCACTGGG - Intronic
1091232491 11:133997847-133997869 AAGGAAGCCCAAAAGGAACTGGG - Intergenic
1092065213 12:5584357-5584379 ACTGAATGTCAGAAGGAAGCTGG - Intronic
1092509895 12:9143954-9143976 AATTAAGCTGAGAAGAAACTGGG + Intergenic
1093335353 12:17898753-17898775 ACTAAAGTTCAGAAGGAACTGGG - Intergenic
1094823046 12:34242124-34242146 AATGAACCAAAAAAGGAACCAGG - Intergenic
1095936133 12:47683781-47683803 ACTGAAAATCAGAAGGAATCAGG - Intronic
1096810845 12:54168880-54168902 AATGCTGAACAGAAGGAACCAGG + Intronic
1099344747 12:81484121-81484143 AATGAAACTCTGAAAGTACCAGG - Intronic
1099451244 12:82809832-82809854 AATGACTCTGAGAAGAAACCTGG + Intronic
1099474406 12:83090706-83090728 AATGGATCTAAGAAGGAAGCAGG - Intronic
1100897102 12:99195631-99195653 AAAAAAGCTCAGCAGGAAACAGG + Intronic
1101733846 12:107448103-107448125 AATGAGGCCCAGATGGAAGCGGG + Intronic
1102019249 12:109670337-109670359 ACTGGAGATCAGATGGAACCGGG - Intergenic
1102618876 12:114177773-114177795 AATGAGGATGACAAGGAACCTGG + Intergenic
1102996083 12:117351580-117351602 GAGGAATATCAGAAGGAACCTGG + Intronic
1103212350 12:119176182-119176204 AATGAGGCTCAGTTGGGACCAGG - Intergenic
1103281504 12:119761577-119761599 GATGATGCTCAGAAACAACCAGG + Intronic
1108010842 13:46007414-46007436 AATCATGGTCAGAAGGAGCCTGG + Intronic
1108204969 13:48079109-48079131 ACTGAAGCTCAGAATGAACTGGG + Intronic
1109168088 13:59060531-59060553 GATCAAGTTCAGAAGGAAGCAGG + Intergenic
1110837475 13:80101146-80101168 AATGAGGCATAGAAGTAACCTGG - Intergenic
1112020035 13:95363600-95363622 ATTGATGTTCAGAAGGAAGCTGG + Intergenic
1112936253 13:104803381-104803403 AATGAAGCTCATAAGAAATAAGG + Intergenic
1113002208 13:105654171-105654193 AATGAAGGAGAGAAGGAACATGG - Intergenic
1113251713 13:108460675-108460697 AAGGAAACTCTGAAGTAACCAGG + Intergenic
1115374667 14:32661103-32661125 AAAGGAGGTCAGAAGGAACAGGG + Intronic
1116131372 14:40859032-40859054 ACTGCAGCTCAGAAGAAACAGGG + Intergenic
1116251913 14:42496624-42496646 AAAGTAGATGAGAAGGAACCTGG - Intergenic
1116945808 14:50834229-50834251 AAAGAAGTTTAGAAGGAGCCAGG - Intergenic
1118105406 14:62653504-62653526 AATGAAGCTCAGAGGGTAAGTGG + Intergenic
1118915002 14:70095413-70095435 ACTGAGGCACAGAAGGAACCTGG - Intronic
1121033333 14:90677977-90677999 AAAGCAGCTCTGAAGGAAACAGG + Intronic
1127734264 15:61827448-61827470 CATGAAGCTGAGAAGGTTCCTGG - Intergenic
1129534362 15:76299886-76299908 AATGTTGATGAGAAGGAACCAGG - Intronic
1130542279 15:84828934-84828956 CATGAAGCTGTGAAAGAACCGGG - Intronic
1130577722 15:85107152-85107174 AAAGAAGATCAGAGGTAACCAGG + Intronic
1132154349 15:99485311-99485333 CATGAAGGTCAGAAGGCTCCAGG - Intergenic
1132357210 15:101180652-101180674 ACTGAAGCAAAGAAGTAACCTGG + Intronic
1132947032 16:2537667-2537689 ACTGAGGCTCAGAGGGGACCAGG - Intergenic
1132968656 16:2673725-2673747 ACTGAGGCTCAGAGGGGACCTGG + Intergenic
1133428314 16:5712775-5712797 AATGCAGATCAGAGGGAGCCAGG - Intergenic
1134173516 16:11987824-11987846 AATTAAGCTAAAAAGGAACAGGG - Intronic
1134384363 16:13758153-13758175 CAGTAAGCTCTGAAGGAACCTGG - Intergenic
1135036426 16:19081882-19081904 GCTGAAGCTCAGAAGAAACAAGG + Intergenic
1135141614 16:19927010-19927032 AATGAAGATCCAAAGGAACAGGG + Intergenic
1135358360 16:21789872-21789894 AATGAGTCTAAGGAGGAACCAGG + Intergenic
1135456863 16:22605997-22606019 AATGAGTCTAAGGAGGAACCAGG + Intergenic
1136775826 16:32871330-32871352 AATGGGGCTCAGGAGGAACCAGG + Intergenic
1136894790 16:33990182-33990204 AATGGGGCTCAGGAGGAACCAGG - Intergenic
1138258364 16:55591687-55591709 AAATAAGCTTAGAAAGAACCAGG - Intergenic
1141331476 16:83115426-83115448 TATAAAGGTTAGAAGGAACCAGG + Intronic
1141582212 16:85007451-85007473 AATGGAACTCAGAAGCAAGCAGG + Intronic
1141667431 16:85473100-85473122 AATGGAGATCAGCAGGAAGCGGG + Intergenic
1203078242 16_KI270728v1_random:1133439-1133461 AATGGGGCTCAGGAGGAACCAGG + Intergenic
1144450885 17:15377438-15377460 TGTGGAGCTCAGAAGCAACCTGG - Intergenic
1144487806 17:15682019-15682041 AATGAAGCCCAGAAGAAACTTGG - Intronic
1144913216 17:18700272-18700294 ACTGAAGCCCAGAAGAAACTTGG + Intronic
1146568055 17:33930268-33930290 AATGAAACACAAAAGGAGCCAGG - Intronic
1147056401 17:37838602-37838624 AATGTGGATCAGAAGGAAGCGGG - Intergenic
1148330876 17:46813275-46813297 AATGAAGCCCAGAAGGAGGCAGG + Intronic
1149866088 17:60151801-60151823 ACTCAAGCTGAGAAGGGACCAGG + Intronic
1150868817 17:68881790-68881812 AATAATGCTCATTAGGAACCAGG + Intronic
1155365412 18:25044392-25044414 AGTGAAGCTCAGGAAGAACAGGG + Intergenic
1158769305 18:60495585-60495607 ACTGAAGTTCGGAAGGAAGCTGG + Intergenic
1160312748 18:77811223-77811245 AATGGAGCCCAGAAGGCCCCTGG + Intergenic
1160352381 18:78194683-78194705 CATGAAGCTCAGGAGGAAACTGG - Intergenic
1162239408 19:9336999-9337021 AATGAAGTCTAGAAGAAACCAGG + Intronic
1162811514 19:13166975-13166997 AATGATTCTAAGAGGGAACCTGG - Intergenic
1163441045 19:17322797-17322819 CATGAACATCAGAAGGCACCTGG - Exonic
1166258396 19:41621326-41621348 AATGAACAGCAGAAGGTACCAGG + Intronic
1166979077 19:46622135-46622157 ACTGAAGCTCAGAAGAAAGGTGG + Intronic
925422475 2:3724260-3724282 AGTGAATCTCAGAAGCAGCCTGG - Intronic
925491187 2:4395258-4395280 AATGAAGATCAGCAGTAGCCAGG - Intergenic
925565816 2:5253073-5253095 GAGGAAGCTGAGAGGGAACCTGG + Intergenic
927631243 2:24776074-24776096 AATGAAGCTCAAAAGGTCACTGG - Intergenic
928847185 2:35690708-35690730 GATGAAGCACAAAAGGAACTGGG - Intergenic
929291341 2:40195477-40195499 AATGAAGCTGAGAAAGAATTTGG + Intronic
929666137 2:43835458-43835480 AAGGAAGCTGAGAATGACCCTGG + Intronic
930058053 2:47267031-47267053 CATGATGCTTGGAAGGAACCTGG - Intergenic
932489926 2:72114123-72114145 AATGAGGCTCACCAGGAGCCGGG + Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933473176 2:82754010-82754032 AATGATACTCAGAAGGAAAAGGG + Intergenic
934116149 2:88796251-88796273 AATAAAGCTCAGAAGGTGACTGG - Intergenic
936937406 2:117851611-117851633 AATGAAGCTATGAAGGGAGCAGG + Intergenic
937254731 2:120547146-120547168 ACTGAGGCCCAGAAGGAATCAGG + Intergenic
939711383 2:145524550-145524572 TATTAAGTTCAGAAGGAACCTGG - Intergenic
940738626 2:157481294-157481316 AATGAACCTAATAAGGCACCAGG + Intronic
940965176 2:159829152-159829174 AATGAAGACCAGAAATAACCAGG - Intronic
941584730 2:167343499-167343521 AAGCAATGTCAGAAGGAACCAGG + Intergenic
942707035 2:178785889-178785911 TATGAGTCTCAGAAGGAGCCTGG + Exonic
942806371 2:179935978-179936000 AGTGCAGCTCAAAAGGAAGCAGG - Intergenic
943172582 2:184422136-184422158 AATGTACCTCAGAAGTGACCAGG - Intergenic
945740249 2:213651045-213651067 ATTGAATCTCAGTAAGAACCTGG - Intronic
946060892 2:216940676-216940698 AATGAAGCTCTGAAGGATAGTGG - Intergenic
946861558 2:224004379-224004401 AATGAAGCTCTGGAGAAACACGG - Intronic
947085926 2:226452881-226452903 AATGAATCTTAAAAGAAACCAGG + Intergenic
947375515 2:229491105-229491127 GAGCAAGCTGAGAAGGAACCTGG - Intronic
948926211 2:241100055-241100077 AAGGAAGCTCACAAAGAACAGGG + Intronic
1170985730 20:21256510-21256532 AATGAAGGAAAGAAGGAACGAGG + Intergenic
1171238728 20:23548287-23548309 ACTGCAGCTCAGCAGGAGCCAGG + Intergenic
1171888829 20:30688101-30688123 AATGAAGCTTAGAAGATAACTGG + Intergenic
1172386976 20:34540876-34540898 ACTGAAGGTCAGAAGGAAGCTGG - Exonic
1172544176 20:35746548-35746570 AATCAAGTGCAGAAGGAACCTGG - Intergenic
1173268646 20:41511037-41511059 ACTGAAGCCCAGAACGATCCAGG - Intronic
1175049785 20:56144430-56144452 AATGAGGCTCAGAAGGATTAAGG + Intergenic
1175191116 20:57212778-57212800 AAAGGAGCCCAGAAGGAAGCCGG + Intronic
1175394078 20:58646801-58646823 AATGACGCTCAGCAGAAAACAGG - Intergenic
1176236366 20:64055599-64055621 GATGAGGCTCAGAGGGAACAAGG + Intronic
1177631505 21:23734914-23734936 GATGAACCTCAGAAGTACCCTGG + Intergenic
1178257506 21:31067830-31067852 AATGAAACTGGGAAGGAGCCTGG - Intergenic
1178279702 21:31270922-31270944 ATTGAAGGTCTGAAGGAACTTGG - Intronic
1180078467 21:45475275-45475297 ACTGAAGCTCAGATGGTGCCTGG + Intronic
1180986204 22:19905226-19905248 AATCATGCTCAGAATGAAACGGG + Intronic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
1182399423 22:30063394-30063416 AATCAAGGTAAGAAGGAACTAGG + Intergenic
1182399467 22:30063996-30064018 AATCAAGGTAAGAAGGAACTAGG - Intergenic
1182764309 22:32747577-32747599 AGTGAGGCTCAGAAGGAATAAGG + Intronic
1183241906 22:36663894-36663916 GAAGAGGCTCGGAAGGAACCAGG + Intronic
1184941276 22:47767224-47767246 CATGCAGCTCAGAAGCACCCAGG - Intergenic
949607240 3:5666675-5666697 AATGAAGGCCAGAAGGCACTGGG + Intergenic
949809375 3:7989771-7989793 AGTAAAGGTCAGAGGGAACCAGG + Intergenic
950717578 3:14860565-14860587 ATTGAGGATCAGAAGTAACCAGG + Intronic
951129724 3:19027775-19027797 AATGAAGCCCAGAAGGCAATAGG + Intergenic
952109221 3:30103621-30103643 GATGAAGGTCAGAGGAAACCAGG + Intergenic
954097715 3:48342976-48342998 AATACAGCTCAGAAGAAGCCTGG + Intergenic
954241922 3:49300481-49300503 AGTGAGGGTCAGCAGGAACCAGG + Exonic
955795743 3:62635083-62635105 AATGAATCTCAAAAACAACCTGG - Intronic
957857957 3:85903518-85903540 AATGAAGGTCAGAAGGTAGTTGG - Intronic
959581555 3:107988116-107988138 AATGAAGGTCACCAGGAGCCTGG + Intergenic
960904278 3:122583958-122583980 AAAGAAACTCAGAAGAAGCCTGG - Intronic
961981295 3:131081857-131081879 AAAGAAGCTCAGAAGGAAAAGGG + Intronic
963720372 3:148855042-148855064 AATCTACCTCAGAAGGAACACGG + Intronic
964527077 3:157626364-157626386 AGTGAGGCTCAGCAGGAACCAGG + Intronic
967019044 3:185506538-185506560 AATAAAACTAAGAAGAAACCAGG + Exonic
967584968 3:191201919-191201941 TATGAAGATCAGAAGTAATCTGG - Intronic
967816647 3:193804740-193804762 AATGAAGCTGAGGAGAAACTTGG - Intergenic
967852671 3:194093911-194093933 AATGAGGCTGAGAAGGAAGGGGG + Intergenic
970175306 4:13333413-13333435 CATGAAGCTGAGATGGAAGCTGG + Intergenic
971231901 4:24806860-24806882 AGTGCAGCCCAGAAGGACCCAGG - Exonic
973853525 4:54986653-54986675 AATGAATCCCAGAAGCAACGTGG - Intergenic
973988108 4:56375669-56375691 AATGAAGCAGATAAGGAATCTGG - Intronic
976056793 4:81078485-81078507 AAGAAAGCTCAGAGAGAACCAGG + Intergenic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
978719414 4:111889807-111889829 AATGCAGCCCAGCTGGAACCTGG + Intergenic
980144377 4:128963168-128963190 AATGAAGGTCAGAAGGTAGTGGG + Intronic
982981032 4:162135572-162135594 AATGAGGCTAAAAAGGACCCAGG - Intronic
983745121 4:171189058-171189080 AATGAAGCTGGGAAGAAATCTGG - Intergenic
984030131 4:174593961-174593983 AATAAAGCTCAGAAAGACACAGG - Intergenic
984081420 4:175253493-175253515 AATTAAGCACAGTGGGAACCAGG + Intergenic
984842613 4:184082166-184082188 AATGAAGCTCCGTGGGAAGCAGG + Intergenic
986417627 5:7544850-7544872 AATGAAACCCAGGAGTAACCTGG + Intronic
988229758 5:28460307-28460329 AATGACTCTCAGAAGGATGCAGG - Intergenic
988907561 5:35804805-35804827 AATTAAGCAAAGAAGGAACCTGG - Intronic
989189286 5:38654644-38654666 AATGAAGCCAAGAAGAAACAAGG + Intergenic
990421166 5:55635368-55635390 AATAAAGCTCAGAAAGAAAAGGG + Intronic
992044620 5:72873461-72873483 AAAGATGCTCAGAAAGAAGCTGG - Intronic
992487758 5:77211506-77211528 AAGGGAGCGCAGAAGGAAGCAGG + Intronic
993139732 5:84016702-84016724 AATGAGGCCCAGGAGTAACCAGG - Intronic
993358646 5:86946015-86946037 AAGGAAGCCCTGAAGGAAGCAGG + Intergenic
994658766 5:102627777-102627799 CATGGGGCTCAGATGGAACCTGG - Intergenic
994754139 5:103774115-103774137 AAAGAAACTGAGAAGGAACCAGG + Intergenic
995016273 5:107313240-107313262 ACTGAATAACAGAAGGAACCAGG + Intergenic
998006369 5:138659631-138659653 ACTGAAGCTCAGAAGAATCCGGG - Intronic
998310059 5:141121140-141121162 ACTGAAGCTCAGAGGGTAACAGG - Intronic
999805458 5:155076950-155076972 TATGAAGTTCAGAATGAAGCTGG - Intergenic
1000925975 5:167194606-167194628 AATGACGGTGAGAAGGAACAGGG + Intergenic
1001027787 5:168238688-168238710 AAGGAAGCTCATAAAAAACCTGG - Intronic
1001363347 5:171110660-171110682 AATGAAGATCAAAAAGAACAGGG + Intronic
1001837771 5:174846108-174846130 GACGAAGCTCAGAAGGGAACTGG + Intergenic
1003343607 6:5244932-5244954 GATGAGCCTCAGCAGGAACCAGG - Intronic
1006582533 6:35085099-35085121 AGTGAAGGTTAGGAGGAACCAGG + Intronic
1007745780 6:44042289-44042311 CTTGAAGTTCAGAGGGAACCTGG - Intergenic
1007940081 6:45772226-45772248 AATGAAGCTCTCAAGGAAACAGG + Intergenic
1008120500 6:47610476-47610498 AATCAGGCTCAGAGGGAACATGG - Intronic
1009015764 6:57899328-57899350 TATGAAGGTCAAAAGGTACCTGG - Intergenic
1009882384 6:69584522-69584544 AATTAAGCTCAAAAGGACACAGG - Intergenic
1012666571 6:101978130-101978152 CATGAAGATCAGAAGCCACCTGG - Intronic
1012814703 6:104008509-104008531 AATGAAGCTTAGAAGGATTTAGG - Intergenic
1013732800 6:113188690-113188712 AATGAAGTCCAGAAGAAACGAGG - Intergenic
1014480661 6:121932514-121932536 AATAATGCTCAGCAGGAATCAGG - Intergenic
1016521075 6:144947546-144947568 AATAAAGCAGAGAAGGAAACAGG - Intergenic
1017315655 6:153028252-153028274 AATGTAGCCCAGAAGGATTCTGG + Intronic
1021593211 7:22287414-22287436 GATGAACCTAAGAGGGAACCAGG + Intronic
1022466120 7:30654157-30654179 AATGAAGCTTAAATGGCACCGGG - Intronic
1024081151 7:45856242-45856264 AAGGAAGGACAGAAGGGACCAGG - Intergenic
1028584822 7:92442493-92442515 AATGAAGTCCACAAGGCACCGGG + Intergenic
1030406785 7:109125051-109125073 AATGAAGATCAAAAGAAACAGGG + Intergenic
1033329702 7:140407841-140407863 AGTGAAGGTCAGAGGGCACCGGG + Exonic
1035332640 7:158106313-158106335 GATGAAGCTCAGAAAGGAGCTGG - Intronic
1037196921 8:16201764-16201786 AAAGAAGCTGAGAAACAACCTGG - Intronic
1037280178 8:17232233-17232255 AATGTAGTTCAGAAGGAACTGGG - Intronic
1037667879 8:20986430-20986452 AATGAAGAAAAGAAGGAAACTGG + Intergenic
1038609850 8:29050315-29050337 AATAAAGCTGTGAAGGAAGCTGG - Intronic
1038714169 8:29976733-29976755 AATGGAGGTCAGAAGAAACTGGG - Intergenic
1039525249 8:38208775-38208797 AATAAAACTCAGAAGGAATAAGG - Intronic
1039574863 8:38614969-38614991 AATAAAGCTGAGAAGGAGACAGG + Intergenic
1039871539 8:41549997-41550019 AAGGAAGCTCAGAGGGAGGCAGG - Intergenic
1041740792 8:61154300-61154322 AATGAAGCTCTGAATGAAAGTGG + Intronic
1041947644 8:63464182-63464204 AATAAAGCACAGAAGGTGCCTGG - Intergenic
1042008465 8:64209974-64209996 AATGAACCTCAGGAGGACTCTGG - Intergenic
1043504670 8:80890470-80890492 AATGAAGCTCAGGAGCCAGCAGG - Intergenic
1048382113 8:133874398-133874420 AATGAAGCACAGAAGCTCCCTGG + Intergenic
1048550687 8:135431111-135431133 ACTGATGCTCAGAATTAACCTGG - Intergenic
1051484974 9:17598487-17598509 ATTGAGGCTGAGAAGAAACCAGG + Intronic
1053077867 9:35150454-35150476 ACTGCAGCTCAGAAGAAACAAGG + Intergenic
1053476330 9:38384548-38384570 AAGGAAGCCCAGAGGGAAGCAGG - Intergenic
1055295380 9:74827811-74827833 AATGAAGCTCAGAAGGAACCTGG - Exonic
1055733074 9:79299055-79299077 AATGAAACTCAGAAATAATCAGG + Intergenic
1056745368 9:89296725-89296747 AGTTAAGCTGAGAAGGAACTGGG - Intergenic
1056839775 9:89989333-89989355 AAAGAACTTTAGAAGGAACCTGG + Intergenic
1058525660 9:105855569-105855591 TATGAAGCTTAGAGGGAACTGGG - Intergenic
1059315453 9:113421904-113421926 AAAGAAGCTCAGAAGTAGGCAGG + Intronic
1060057037 9:120423511-120423533 AATAAAGCTCAGAATGTAGCTGG + Intronic
1061070092 9:128304322-128304344 AAGGAGACTGAGAAGGAACCAGG + Intergenic
1186476584 X:9862454-9862476 ACTGAAGCTCACTAGGAAGCTGG + Intronic
1187515790 X:19968731-19968753 AAGAAACCTGAGAAGGAACCTGG + Intronic
1190129322 X:47732613-47732635 TAGGAAGCTCAGAAGGAAACTGG - Intergenic
1191059189 X:56277154-56277176 AATGAACCACATAAGGCACCAGG - Intronic
1191177975 X:57526484-57526506 AATCAATATCAGAAGGAACTTGG - Intergenic
1191915294 X:66194537-66194559 AATGAAGTTCAGAAGAGTCCAGG + Intronic
1192332235 X:70185108-70185130 GATGAAGCTGGGAAGGAAACTGG - Intronic
1193322359 X:80137777-80137799 AATAAAACTGAGAAGGATCCAGG - Intergenic
1193748288 X:85310906-85310928 CATGAAGCCCAGAAGGAACTAGG + Intronic
1196690204 X:118550915-118550937 AATGAAGCTCATAAGCAAATGGG + Intronic
1197162686 X:123341754-123341776 GGTGTAGCTCAGAAGGTACCTGG + Intronic
1198797675 X:140416268-140416290 GAAGAAGCTCAGCAGGAACCAGG - Intergenic
1199704224 X:150410136-150410158 ACTGAAGCTCAGAAGAAGTCAGG + Intronic
1200104064 X:153702708-153702730 AATGGGGCTCAGGAGGAACCAGG - Intronic
1201861007 Y:18597219-18597241 AAGTCAGCTCAGAAGGAAACTGG - Intergenic
1201872316 Y:18723161-18723183 AAGTCAGCTCAGAAGGAAACTGG + Intergenic
1202165109 Y:21979285-21979307 AAATCAGCTCAGAAGGAAACTGG + Intergenic
1202189944 Y:22231372-22231394 CATTAAGCTGAGAAGGAACTGGG + Intergenic
1202226247 Y:22607089-22607111 AAATCAGCTCAGAAGGAAACTGG - Intergenic
1202316868 Y:23588576-23588598 AAATCAGCTCAGAAGGAAACTGG + Intergenic
1202553897 Y:26081482-26081504 AAATCAGCTCAGAAGGAAACTGG - Intergenic