ID: 1055296688

View in Genome Browser
Species Human (GRCh38)
Location 9:74840496-74840518
Sequence CTGCCTCACCCCAGGTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 343}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055296688_1055296691 -3 Left 1055296688 9:74840496-74840518 CCAGAGAACCTGGGGTGAGGCAG 0: 1
1: 0
2: 1
3: 23
4: 343
Right 1055296691 9:74840516-74840538 CAGAAATACTTCAAACAGGCAGG No data
1055296688_1055296694 6 Left 1055296688 9:74840496-74840518 CCAGAGAACCTGGGGTGAGGCAG 0: 1
1: 0
2: 1
3: 23
4: 343
Right 1055296694 9:74840525-74840547 TTCAAACAGGCAGGGTGCGGTGG No data
1055296688_1055296692 -2 Left 1055296688 9:74840496-74840518 CCAGAGAACCTGGGGTGAGGCAG 0: 1
1: 0
2: 1
3: 23
4: 343
Right 1055296692 9:74840517-74840539 AGAAATACTTCAAACAGGCAGGG No data
1055296688_1055296693 3 Left 1055296688 9:74840496-74840518 CCAGAGAACCTGGGGTGAGGCAG 0: 1
1: 0
2: 1
3: 23
4: 343
Right 1055296693 9:74840522-74840544 TACTTCAAACAGGCAGGGTGCGG No data
1055296688_1055296690 -7 Left 1055296688 9:74840496-74840518 CCAGAGAACCTGGGGTGAGGCAG 0: 1
1: 0
2: 1
3: 23
4: 343
Right 1055296690 9:74840512-74840534 GAGGCAGAAATACTTCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055296688 Original CRISPR CTGCCTCACCCCAGGTTCTC TGG (reversed) Intronic
900203802 1:1422566-1422588 CTACCTCACGCCAGCTTCCCAGG + Intergenic
900206417 1:1433717-1433739 CTGGCTGACCCCATGCTCTCTGG + Intergenic
900898036 1:5497519-5497541 CTGCCTCACCCCAGCCTCCTTGG + Intergenic
901089121 1:6629702-6629724 CTGGCACAGCCCAGGTGCTCGGG + Intronic
901474045 1:9476914-9476936 CTGCCTCACCCCCTGCTTTCAGG + Intergenic
901632931 1:10656728-10656750 CCTCCTCCCTCCAGGTTCTCGGG - Exonic
902128886 1:14241155-14241177 CTGCCCCACCCAAGGTTGTTGGG - Intergenic
902223180 1:14979671-14979693 CTGCCTCCCCACAAGTCCTCAGG - Intronic
903321955 1:22548594-22548616 CTCCCTCACAGCAGGCTCTCTGG + Intergenic
903349592 1:22710177-22710199 CAGCCCCACCCCAGGCCCTCGGG + Intergenic
903632751 1:24788856-24788878 CTGCCCCTTCCCTGGTTCTCAGG - Intronic
904282911 1:29433712-29433734 CAGCCTCACCCCAGTCTCTTGGG + Intergenic
904556235 1:31366615-31366637 CTGCCTAACCACAGGGCCTCAGG - Intronic
904773152 1:32892290-32892312 CTGCCTGGTCCCAGGTTCTGGGG + Intronic
904859159 1:33521709-33521731 CTGCCCCACCCCGGGCTCCCCGG - Intronic
905522776 1:38613299-38613321 CTGCCTCATCTCAGGTTATCGGG - Intergenic
905672267 1:39799568-39799590 CTGCCACCCCCCAGGTGCTGGGG + Intergenic
905674693 1:39817240-39817262 CTGCCACCCCCCAGGTGCTGGGG - Intergenic
906791415 1:48661433-48661455 CTGGCTCTCACCTGGTTCTCTGG - Intronic
908123642 1:61008697-61008719 CTGCCTCACCCCAGCTGCATTGG - Intronic
910213686 1:84819979-84820001 CTGCCTGACCCAGAGTTCTCAGG - Intronic
910496304 1:87832466-87832488 CTGGCTCACACCAGTTTCTGAGG - Intergenic
911112191 1:94201269-94201291 CTGCCTTTCCCCATGTTCTCTGG - Intronic
912325184 1:108751135-108751157 CAGCCCCACCCCAGGACCTCTGG - Intronic
914348895 1:146822658-146822680 GTCTCTCTCCCCAGGTTCTCTGG + Intergenic
915119992 1:153623981-153624003 CCTCCTCACCTCAGGTTCTAAGG - Intronic
917815704 1:178707731-178707753 CTGCCTCACGGCAAATTCTCTGG + Intergenic
919817205 1:201449032-201449054 CAGCCTCACCCCTGGCTCCCTGG + Intergenic
920288740 1:204901344-204901366 CTGCTTCTCCCCAGCTTCTAAGG - Intronic
920301179 1:204990015-204990037 CTGCGTCACCCCGGGATCCCAGG + Intronic
920363933 1:205438299-205438321 CTCCCTCACCCCAAGAGCTCAGG + Intronic
922318495 1:224463531-224463553 ATGCCTAACCCCAGCTACTCGGG - Intronic
1064425548 10:15226147-15226169 CTGCCTCACCCCAGAAACCCAGG + Intronic
1065963807 10:30754711-30754733 CTGCATCACCCCTGGCTCACGGG - Intergenic
1067183185 10:44005801-44005823 CCGCAGCACCGCAGGTTCTCCGG - Intergenic
1067195709 10:44116314-44116336 CTGCTTCACCCTAGGGTCACGGG + Intergenic
1068476641 10:57535473-57535495 CAGCAGCTCCCCAGGTTCTCGGG + Intergenic
1069643848 10:69977085-69977107 CTGCCTAACCCCAGGGCGTCTGG - Intergenic
1069676812 10:70254616-70254638 GTGACTCACCCAAGTTTCTCAGG - Exonic
1069895858 10:71679624-71679646 CTGCTCCACCCCAGGTGCTCCGG - Intronic
1070968107 10:80542280-80542302 CTCAGTCATCCCAGGTTCTCAGG + Intronic
1070972387 10:80578336-80578358 CAGCCTCCCCTTAGGTTCTCAGG - Intronic
1072010751 10:91301061-91301083 CCACCCCACCCCAAGTTCTCAGG - Intergenic
1072460421 10:95613325-95613347 CTGCCTCCCCCCAGTGTCTTTGG - Intronic
1072562107 10:96586467-96586489 GCGCCGCACCCCAGGGTCTCGGG - Intronic
1072668022 10:97408601-97408623 CTGCCACACCCAAAGTTCTGTGG + Intronic
1073208388 10:101780501-101780523 CTGTCTGGCCCCAGGTTGTCTGG + Intergenic
1073357283 10:102867121-102867143 GTGCCTCACCACAGGTTTTGTGG - Intronic
1075651566 10:124130898-124130920 CTGCCCCACCTCAGGCTCTCAGG + Intergenic
1077244920 11:1532077-1532099 CTGACTCAACCCAGATTCTCAGG + Intergenic
1078151862 11:8766362-8766384 CAGCCTCACCCTAGGCTCCCAGG + Intronic
1079097317 11:17519179-17519201 CTGCCTCACTCCCTGTTCCCCGG - Intronic
1079160330 11:17986501-17986523 CTGAGTCACCCCAGCTGCTCTGG - Intronic
1080133671 11:28827493-28827515 CTGCCTCATTGCAGGTTCTCTGG + Intergenic
1080720303 11:34841957-34841979 CTGCCTCCTCCCCTGTTCTCAGG + Intergenic
1081618161 11:44602768-44602790 CTGTCTCCCCCCAGGATCCCAGG - Intronic
1081870357 11:46380343-46380365 CTGCCCCACCCCACCTCCTCCGG + Exonic
1083872364 11:65497010-65497032 CTCCCTCACCCCCGGGTCTTTGG - Intergenic
1084126437 11:67102190-67102212 CAGCCTCTCCCCAGGTTCTGAGG + Intergenic
1084177998 11:67433411-67433433 CTACCTCACCCCAGATGCCCGGG + Exonic
1084433731 11:69126063-69126085 CTGGCTCACCTGAGGCTCTCAGG + Intergenic
1084630083 11:70342224-70342246 CTGGCTCACACCCGGATCTCCGG - Intronic
1084672150 11:70613614-70613636 AGTCCTCACCCCAGGATCTCAGG + Intronic
1084785232 11:71438176-71438198 CTCTCCCAGCCCAGGTTCTCAGG + Intronic
1085040252 11:73322661-73322683 GAGCCTCTCCCCAGGTGCTCTGG - Intronic
1085488679 11:76892518-76892540 CTGACTGACCCCATTTTCTCTGG + Intronic
1087894250 11:103570478-103570500 AGCCCTCACTCCAGGTTCTCAGG - Intergenic
1089295979 11:117468587-117468609 CGGCCTCACCCCACTTTCTGAGG + Intronic
1089379657 11:118018692-118018714 TTCCCTCACCTCAGGGTCTCTGG - Intergenic
1091279400 11:134373581-134373603 ACCCCTCACCCCAGCTTCTCAGG + Intronic
1091803461 12:3339781-3339803 CTGCCTTGCCCTGGGTTCTCTGG - Intergenic
1092187400 12:6490983-6491005 CAGTCTCACCCCAGTTGCTCAGG + Intergenic
1092669429 12:10846635-10846657 CTGCCTCACACTAGCCTCTCAGG - Intronic
1092672651 12:10881842-10881864 CTGCCTCACATCAGGCTTTCAGG - Intronic
1093351579 12:18108982-18109004 TTGACTCACCCCAGGTTTTGTGG - Intronic
1096816179 12:54203346-54203368 CTGCCTCCCTCCAGGAGCTCTGG - Intergenic
1101477526 12:105064733-105064755 TTGACTCAGCCCAGGCTCTCAGG - Intronic
1102029281 12:109730698-109730720 CTGGCACACCACAGGTGCTCAGG + Intronic
1102720634 12:115013290-115013312 CGGCCCCAGCCCAGGGTCTCTGG + Intergenic
1103149850 12:118627635-118627657 CTGCCCCACCCCTGTTCCTCTGG - Intergenic
1103355891 12:120319963-120319985 CTGCCTCTCCCCACTTGCTCTGG + Intergenic
1104390767 12:128389051-128389073 CTGCATCTCGCCAGGGTCTCTGG - Intronic
1104903729 12:132202751-132202773 CCGCCACACCCCAGCGTCTCTGG - Intronic
1106136868 13:26980033-26980055 ATGCCTCACCCCAGGCACTTGGG + Intergenic
1106518204 13:30473188-30473210 CTGCCTCAGCCCGAGTTTTCCGG + Intronic
1108003439 13:45925177-45925199 CTGCCTCACCCCCTGTCCCCAGG + Intergenic
1109170864 13:59095790-59095812 CTGCTTCACCTCAGGTCATCAGG + Intergenic
1111685132 13:91492419-91492441 CTTCCCCACCCCAGATTCTCAGG - Intronic
1112463174 13:99620967-99620989 CTGCCACCCCTCATGTTCTCTGG + Intronic
1113148386 13:107234615-107234637 CTCCCTCACCAAAGGTTATCTGG + Intronic
1113486115 13:110653387-110653409 CTCCCTCACCCGAGGTGCTGTGG + Intronic
1113742375 13:112720475-112720497 TTGCCTCAACCCAGGCTCACGGG - Intronic
1114277308 14:21158480-21158502 CTGCCTTGCCCAAGGTTCACAGG + Intergenic
1114278062 14:21165764-21165786 CTGCCTTGCCCAAGGTTCACAGG - Intergenic
1114466836 14:22929158-22929180 CCCCCTCACCCCTGCTTCTCCGG + Intronic
1114911495 14:27204539-27204561 CTGCCTAACCACTTGTTCTCAGG - Intergenic
1114961779 14:27900886-27900908 TAGCCTTACCCCAGGTGCTCAGG - Intergenic
1115906847 14:38210497-38210519 CCGCCGGACTCCAGGTTCTCAGG - Exonic
1116946504 14:50840363-50840385 CAGCCTCCTCCCAGGTACTCTGG + Intergenic
1117024570 14:51606873-51606895 CCTCCCCACCTCAGGTTCTCAGG - Intronic
1117461103 14:55945578-55945600 CACCCACCCCCCAGGTTCTCAGG - Intergenic
1117906119 14:60589321-60589343 CTGTCTCACAACAGCTTCTCAGG - Intergenic
1118989086 14:70781820-70781842 CTGTACCAGCCCAGGTTCTCTGG + Intronic
1121016524 14:90552526-90552548 CTGCCCACCCCCAGGCTCTCAGG + Intronic
1121828997 14:97033713-97033735 CTTCGTGACCCCAGCTTCTCAGG + Intergenic
1122119634 14:99545228-99545250 CTGCCTCTCCCCAGCTTCAGGGG + Intronic
1122546923 14:102528137-102528159 CTGCCTTACCCCAGGATGGCAGG - Intergenic
1123042786 14:105497203-105497225 CTGCCTGCGCCCAGGTTCTCTGG - Intronic
1124497400 15:30194766-30194788 ATGACTCACCCAAGGTTCTCAGG + Intergenic
1124746173 15:32343881-32343903 ATGACTCACCCAAGGTTCTCAGG - Intergenic
1124848881 15:33316905-33316927 TGGGCTCACCCCAGGATCTCTGG + Intronic
1125749839 15:42020780-42020802 CTGCCTGAGCCCAGGTCCTTGGG + Intronic
1126110909 15:45174177-45174199 CAGCCTCGCCTCAGGTTGTCAGG + Intronic
1126351170 15:47746241-47746263 GTGCCTCATCAGAGGTTCTCAGG - Intronic
1128067564 15:64774658-64774680 CTGCCAAAGCCCAGGTTCTGGGG + Intronic
1129113106 15:73349712-73349734 CTGACTCACCCCTGATTCTGAGG - Intronic
1129608320 15:77035494-77035516 CTCCCTGTTCCCAGGTTCTCTGG + Exonic
1131683786 15:94750557-94750579 CTGCCTCACCCCTGGCTTTCTGG + Intergenic
1132265209 15:100464139-100464161 CTCCCTCACCACTGGTTCACTGG - Intronic
1132379758 15:101358334-101358356 CTGCCTAAGGCCAGATTCTCAGG - Intronic
1132405587 15:101540403-101540425 CTGCCTCACACCAAGTGCTTAGG - Intergenic
1132799689 16:1745890-1745912 CTGCCTCTGCCCAGCCTCTCTGG - Intronic
1133975297 16:10596157-10596179 CTCCCCCACCCCTGGTTCCCTGG + Intergenic
1134005891 16:10818633-10818655 CAGCCTCAGCGCAGCTTCTCGGG + Exonic
1134615799 16:15650368-15650390 CTGCCCCGCCCCAGGATCCCGGG + Intronic
1136669063 16:31839601-31839623 CTGCCTCTCCTCACATTCTCAGG + Intergenic
1136866637 16:33763957-33763979 CTGCCTCACCACAAGAACTCTGG + Intergenic
1139478618 16:67215945-67215967 CTCCCTCACCCAGGATTCTCAGG + Intronic
1139985140 16:70892897-70892919 GTCTCTCTCCCCAGGTTCTCTGG - Intronic
1140282082 16:73564257-73564279 CTGCATAACCCCAGGTGCCCTGG + Intergenic
1140294562 16:73695756-73695778 CTGGCTCACAGCAGGTGCTCAGG + Intergenic
1141851544 16:86649662-86649684 CTGCCTGATCCCTGCTTCTCTGG + Intergenic
1142027135 16:87820465-87820487 CTGCCCCATCCCAGGGACTCAGG + Intergenic
1142175403 16:88642874-88642896 CAGCTTCACCCCAGCTTCTACGG + Intergenic
1142605048 17:1076834-1076856 GTGCCTCACCCTGAGTTCTCAGG - Intronic
1142621162 17:1166486-1166508 CTGCCACACCCCCGGGCCTCCGG - Intronic
1142638723 17:1272624-1272646 GAGCCTCACCCCACGTGCTCTGG - Intergenic
1142704274 17:1684574-1684596 CCGCCGCTCCCCAGATTCTCCGG - Exonic
1142744372 17:1948361-1948383 CTGCCACAACTCAGGTTCTGGGG - Intronic
1145252333 17:21303394-21303416 CTGCCTCCCCTCAGGTTTGCTGG + Intronic
1146272487 17:31493468-31493490 CTCCCTTACCCCAAGTTCACCGG - Intronic
1147561792 17:41513833-41513855 CTGCCTCTCCCCACCTTCTTTGG - Exonic
1148002409 17:44397605-44397627 CTACTTCACCCCATCTTCTCAGG - Exonic
1148386978 17:47241154-47241176 CTGCCACTCACCAGCTTCTCTGG - Intergenic
1148521356 17:48278904-48278926 CTCCCTCAGCCCAGGTTTCCTGG - Intronic
1150213641 17:63455102-63455124 CTGTCTGAGCCGAGGTTCTCTGG + Intergenic
1150429551 17:65104150-65104172 CCACCTCACCCCAGGTGGTCAGG - Intergenic
1150866133 17:68852290-68852312 CTGCCTGCCCCCAGGTTAACAGG - Intergenic
1151463921 17:74272497-74272519 CTGGCTCGCACCAGTTTCTCGGG - Intergenic
1151799876 17:76372316-76372338 CTCCCTCTCCCCAGAGTCTCTGG + Intronic
1151924439 17:77184167-77184189 CTGCATCACGCCAGGCTCTGTGG + Intronic
1151999335 17:77635481-77635503 GTGTCTCTCCCCAGGTTCCCAGG - Intergenic
1152065077 17:78107977-78107999 CAGCCTAACCCCAGAATCTCAGG + Exonic
1152342640 17:79733747-79733769 CTTCCCCACTCCAGGGTCTCGGG + Intronic
1153193833 18:2571435-2571457 CTGCGTCACCCCAGGAACTGGGG - Exonic
1154355334 18:13620053-13620075 CAGCCTCACCCTCGGTTCCCAGG + Intronic
1155025175 18:21934602-21934624 CTGCCCCACCCCAGGGTTTGAGG + Intergenic
1156457808 18:37304604-37304626 CTGCCTCTCCCCAGGTGGACTGG - Intronic
1156469533 18:37368661-37368683 CTGCCTGACCCCAGGGTTTGGGG + Intronic
1157395245 18:47335783-47335805 TTGCCTAATCCCAGGTTCTGAGG + Intergenic
1160014461 18:75129545-75129567 CCGCCTTACACCAGCTTCTCTGG + Intergenic
1160262259 18:77305521-77305543 CTGCCACACTCGAGGTCCTCAGG - Intergenic
1160784238 19:892338-892360 CGGCCTCACCCTAAATTCTCAGG + Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1160988957 19:1852855-1852877 CTCCCTCCCCCCAGGATCCCAGG + Exonic
1161422982 19:4185828-4185850 CTGCCTCACCCCTGGCTCCATGG - Intronic
1161496925 19:4591525-4591547 CTGTCTCAGCCCAGGTTCCTTGG - Intergenic
1161627368 19:5335138-5335160 CTGCCTCATCCGAGGGTCCCAGG + Intronic
1161706647 19:5825259-5825281 CTGCCCCACCGCAGGTGCTGTGG + Intronic
1163433998 19:17284253-17284275 CTGCTGGACCCCAGGTACTCAGG + Exonic
1163696083 19:18764233-18764255 CTGACTCACCCCAGGAGATCTGG - Intronic
1164675958 19:30101661-30101683 CTGGCTCTCCACAAGTTCTCTGG + Intergenic
1165167811 19:33869375-33869397 TTCCCTCACCCCATGTCCTCAGG - Intergenic
1166882906 19:45940080-45940102 ATGGCTCCCACCAGGTTCTCAGG + Exonic
1166986689 19:46664389-46664411 CTGCTTAACCCAAGGTTCTTGGG + Intergenic
1167334429 19:48875763-48875785 CTGCCTCACCCCTGCTGCCCGGG + Exonic
1167613700 19:50519407-50519429 CTCCCTCTCCCCAGGTGATCCGG - Exonic
1167949077 19:53012010-53012032 ATACCACACCTCAGGTTCTCGGG - Intergenic
925231643 2:2238137-2238159 CCCCCTGACCCCATGTTCTCTGG - Intronic
925780229 2:7375216-7375238 CTGGCTCTCCCCAGGCTCTTGGG - Intergenic
925910529 2:8570800-8570822 GTGCCTGACCCAAGGTTCCCAGG - Intergenic
925971319 2:9108455-9108477 CTGCCTCTCCCCAGTGCCTCTGG + Intergenic
926272474 2:11377080-11377102 CTGCCTCTCCCCAGAGGCTCTGG - Intergenic
927883728 2:26706216-26706238 CTGGCTCACCCCAGGAGCTTTGG - Intronic
930891919 2:56400228-56400250 CTGCCACAGCCCAGGGGCTCAGG - Intergenic
931704724 2:64937919-64937941 CTTCCTGTCCCCAGGTTCACTGG - Intergenic
932312409 2:70754395-70754417 CTTCCACATCCCAGGTACTCAGG + Intronic
933230949 2:79806605-79806627 CTACCTCCTCCCATGTTCTCTGG + Intronic
934635339 2:95982546-95982568 CTGCCTCACCACAAGAACTCTGG + Intronic
934798293 2:97122677-97122699 CTGCCTCACCACAAGAACTCTGG - Intronic
934835133 2:97580752-97580774 CTGCCTCACCACAAGAACTCTGG + Intronic
935329648 2:101967635-101967657 CACCCTCACCCCAGGTTTGCAGG + Intergenic
936151336 2:110023942-110023964 CTTCCTCACCCCACCTTCCCTGG + Intergenic
936193339 2:110347427-110347449 CTTCCTCACCCCACCTTCCCTGG - Intergenic
937530072 2:122817542-122817564 CTGCCTCGCCCCCTGTCCTCAGG - Intergenic
937606255 2:123804801-123804823 TTGACTCACCTCAGGTGCTCAGG + Intergenic
937994065 2:127679871-127679893 CTGCCACAGCCCAGGTCCTGGGG + Intronic
942232633 2:173874198-173874220 CTCCCTCACCCCAGCTGCTCTGG - Intergenic
944896231 2:204168189-204168211 CATCCTCACCCCCGGTTCTGTGG + Intergenic
946142953 2:217706936-217706958 GTTCCTCACCCCAGTCTCTCAGG + Intronic
946245537 2:218385133-218385155 CTGCCTCCTCACAGCTTCTCTGG + Exonic
946854133 2:223936172-223936194 GTGCCTCAGCCCAGCTTCTTGGG + Intronic
947263813 2:228253988-228254010 CTGCCCAACCCCACGATCTCAGG + Intergenic
947415068 2:229886572-229886594 CTGCCTCACCTCAGCCTCCCGGG + Intronic
948261396 2:236606894-236606916 CAGCCTCACCCCAGATCCACTGG + Intergenic
948644238 2:239393681-239393703 CAGCCACAGCCCTGGTTCTCAGG + Intronic
1169266795 20:4172054-4172076 CCCCCTCACCCCAGGCTCCCTGG - Intronic
1169329927 20:4708335-4708357 CTGCCACTACCCTGGTTCTCAGG + Intergenic
1169904214 20:10584601-10584623 GGCTCTCACCCCAGGTTCTCTGG + Intronic
1169907708 20:10620092-10620114 CTGCCACCCACCAGGTACTCTGG + Intronic
1170212281 20:13857536-13857558 CTGCCTGTCCCCAGGGACTCAGG + Intronic
1170306230 20:14941314-14941336 CTGCCTCACCTCTTTTTCTCTGG + Intronic
1170408789 20:16066625-16066647 ATGCCTCAGCCCAGGCTTTCAGG - Intergenic
1171375982 20:24694346-24694368 GGGCCTCCTCCCAGGTTCTCTGG - Intergenic
1171412228 20:24955336-24955358 CTGCATTTCCCCAGGCTCTCAGG - Intronic
1172278181 20:33692296-33692318 CTGCGTCACCCAAGCCTCTCAGG + Intergenic
1174525599 20:51168139-51168161 CAGCCTCACCCCCAGTGCTCAGG + Intergenic
1174630952 20:51956592-51956614 ATGCCTCTTCCCAGGTACTCAGG - Intergenic
1175266606 20:57707301-57707323 CTTCCTCACCCTAGTCTCTCGGG + Intronic
1175617014 20:60408379-60408401 CTGAGTCACCCAAGGTCCTCTGG + Intergenic
1175657991 20:60788662-60788684 CTGCCTCACTGCAGGTTCTCTGG - Intergenic
1175702242 20:61147996-61148018 GTGCCTCTCTCCAGGTTCTCTGG - Intergenic
1175799336 20:61792192-61792214 CTGCCTCTCCCTAAGTCCTCTGG - Intronic
1179421665 21:41241318-41241340 AAGCCTCACCCCAGGCTCTGGGG + Intronic
1180622198 22:17169601-17169623 CAGCAGCCCCCCAGGTTCTCAGG + Intergenic
1181134098 22:20752120-20752142 CTGTCTTACCCCAGGGTGTCAGG - Intronic
1181672939 22:24434202-24434224 CTGCCTTCCCCCAGATCCTCTGG + Intronic
1181777158 22:25168094-25168116 CAGCCTCTTCTCAGGTTCTCTGG - Intronic
1182125132 22:27810642-27810664 AGGACTCACCCCGGGTTCTCTGG + Intergenic
1182721531 22:32405043-32405065 CACCCCCACCCCAGGGTCTCTGG - Intronic
1183353495 22:37346307-37346329 CAGCCTCACCCCACCTGCTCCGG - Intergenic
1183930629 22:41234125-41234147 CTCCCTCATCCCAGGATCCCAGG - Intronic
1184114978 22:42417084-42417106 CTGCCTCCACCCAGGTTGACCGG + Intronic
1184118965 22:42438132-42438154 CTTCCTCACCCACAGTTCTCAGG + Intergenic
1184255181 22:43282401-43282423 GTGCCTCTCCCCAGGGTTTCTGG + Intronic
1184646188 22:45896713-45896735 GAGCCTGAACCCAGGTTCTCAGG - Intergenic
1184691005 22:46117230-46117252 CAGCCTCCCCCCAGGCTCTGGGG - Intergenic
1184730835 22:46370076-46370098 CTGCCACCCTCCAGGGTCTCTGG - Intronic
1185061295 22:48608124-48608146 CTGCCAGACCCCTGCTTCTCGGG + Intronic
1185136590 22:49076869-49076891 CTGCCTCTCCAGAGGTGCTCAGG - Intergenic
1185211060 22:49570699-49570721 CTGCCTCACCCAAGCGTCTATGG + Intronic
949980616 3:9499968-9499990 CTCCCCCACCCCAAGCTCTCGGG + Exonic
951740302 3:25914157-25914179 GTGCCTGACCCTAGGTTCCCTGG - Intergenic
952520148 3:34148685-34148707 TGTCCTCACCCCAGGTTCTTGGG - Intergenic
954331175 3:49891166-49891188 TTGCTTCACCCCAGCTACTCTGG + Intronic
954433402 3:50483317-50483339 CTGCCCCTCCCCAGCTCCTCAGG - Intronic
954882543 3:53845821-53845843 CTGCCCGACCCCAGGCTTTCTGG - Intronic
955803239 3:62707281-62707303 CTGCTTCACCCCAGATCATCAGG - Intronic
958709477 3:97699923-97699945 TTGCCTCAGCCCAAGTTCCCTGG + Intronic
958891889 3:99793105-99793127 CTGCCCCACCCCAAGGCCTCTGG - Intronic
959121633 3:102240069-102240091 CTGGCCCACCCCAGAGTCTCAGG - Intronic
960951882 3:123004622-123004644 ATGACCCACCCCAGCTTCTCTGG + Intronic
961321228 3:126077962-126077984 CCGCCTGGGCCCAGGTTCTCTGG - Intronic
961452111 3:127006898-127006920 CTGCCTCAGCCTGGGTCCTCTGG - Intronic
962215118 3:133514425-133514447 CAGCAGCTCCCCAGGTTCTCAGG + Intergenic
962238953 3:133733936-133733958 CTGCTTCACCCCAGTGTCTCAGG - Intergenic
963059982 3:141217629-141217651 CTTCCTCACCCCAGGACCTTTGG + Intergenic
963929773 3:150991725-150991747 GTGCCTCAGCCCAGGCACTCAGG + Intergenic
964478118 3:157115384-157115406 CTGACTCACCCGAAGTTCTTGGG - Intergenic
964526385 3:157619381-157619403 CTGTCTCTTCCCAGCTTCTCCGG + Intronic
966812167 3:183856423-183856445 CATCCTTACCTCAGGTTCTCTGG + Intronic
967161875 3:186746298-186746320 CGGCCTCACCCCAGTCTGTCTGG + Intergenic
968422367 4:496510-496532 CTGCCTCCCCTCAGCTTTTCGGG - Intronic
968464160 4:742155-742177 CTCTCTCTCCCCAGGCTCTCGGG + Intronic
968596565 4:1489086-1489108 CAGCCCCACCCCAGGTGCTGAGG - Intergenic
970161450 4:13193368-13193390 CTGCCCCACTCTTGGTTCTCAGG + Intergenic
970427348 4:15957904-15957926 GGGCCTCACCCCAGATACTCTGG + Intergenic
970432347 4:16000828-16000850 CTGCCCCTCCCCAGGTCCCCAGG - Intronic
970477327 4:16436886-16436908 CTGCCCCATCCCAGGTTCAAAGG - Intergenic
970800672 4:19969713-19969735 CTGCATCACTGCATGTTCTCTGG + Intergenic
970851964 4:20613768-20613790 CTGCCTCTCCCCAGATGCTGAGG - Intronic
971114749 4:23631738-23631760 CTTCCTCACCCCAGGTAAACTGG + Intergenic
972245501 4:37243134-37243156 CTGTCTGCCCCCTGGTTCTCAGG + Intergenic
977772027 4:100871001-100871023 CTACCCCACCCCAGCTACTCAGG - Intronic
981549063 4:145924541-145924563 CTGCCTCAAACCAGCTTCTCAGG - Intronic
982490325 4:156021721-156021743 CTGCCTCACCCCATCTCCTTTGG + Intergenic
984105641 4:175541822-175541844 CTGCCTCATCCCAGGTGATTTGG - Intergenic
985235661 4:187871223-187871245 ATGCGTCACCCAAGGTTCACGGG - Intergenic
985793768 5:1947090-1947112 CTGCCTCCTCCCAGGGGCTCTGG + Intergenic
992660037 5:78950314-78950336 TTTCCTCAGCCCAGCTTCTCTGG - Intronic
994885612 5:105557629-105557651 CTGGCTAACCCCAGGCACTCTGG - Intergenic
995499735 5:112791561-112791583 CTGCTCCACCTCAGGTCCTCAGG - Intronic
997625510 5:135328206-135328228 CTGCCTCACCCCAAGGGCACAGG - Intronic
999226182 5:150026815-150026837 CTGCCTCGCCCCACGTTAACTGG - Exonic
999434520 5:151553016-151553038 CTGCCTCTTCCCTGGTTCTCTGG - Intronic
1001937314 5:175714649-175714671 CTGCCTCACCCCACATGGTCTGG + Intergenic
1002189435 5:177471124-177471146 CCAGCTCACCCCAGGGTCTCTGG - Intronic
1002443490 5:179276088-179276110 CTGACTCATCCCTGGGTCTCAGG + Intronic
1003064761 6:2894582-2894604 CTGCCTCTTCCTAGGTTCTGGGG - Intronic
1003624266 6:7727736-7727758 CTGCCTGTCCCCGCGTTCTCTGG - Intronic
1004075639 6:12341881-12341903 CTGCCTCTCCTCAGTATCTCAGG - Intergenic
1006749509 6:36367734-36367756 ATGCCACACCCCAGGCTCTTTGG - Intronic
1007247507 6:40473036-40473058 CTGCCTCATCCCTGCCTCTCGGG + Intronic
1007617164 6:43186946-43186968 CTCCCTCATACCAGGTTTTCTGG + Exonic
1009824153 6:68845361-68845383 ATGCCTCTCTCCAGGTTCTGGGG - Intronic
1011780978 6:90789124-90789146 ATCCCTCACCCCTGGTTCTCAGG - Intergenic
1015486114 6:133771874-133771896 CTGCCTCTCCCCAAGTCCTGGGG - Intergenic
1016600203 6:145849775-145849797 CTTCCGCTCCCCTGGTTCTCGGG - Intergenic
1017080699 6:150665716-150665738 CTGCATCAGCACAGGTTCTTGGG + Intronic
1018304452 6:162440394-162440416 GTGCCTCACCTCAGGTACTTTGG - Intronic
1018833926 6:167469303-167469325 CTGCCTCACCCCAGACTTCCTGG - Intergenic
1019266103 7:118363-118385 CTGCCTTCCCCCAGTATCTCAGG + Intergenic
1019459979 7:1152725-1152747 CTGCGTCTCCCCAGCATCTCGGG - Intronic
1022472558 7:30690773-30690795 CTGCCTCACCCTAGGCTTCCGGG - Intronic
1023966970 7:44967812-44967834 ATGCCTGACCCCAGAGTCTCTGG + Intronic
1024569238 7:50710250-50710272 CAGCCTCACCCCAAGATCTTGGG + Intronic
1024700402 7:51899814-51899836 CTGCCTCAGCCCAGCTGCACTGG - Intergenic
1024878864 7:54061683-54061705 CTCCCTCACCCCAGTTTATAAGG + Intergenic
1024978272 7:55133653-55133675 CTGTCCCACCCCGGGTTCTGTGG + Intronic
1025912409 7:65839342-65839364 CTGCCTCACCACAGCCTCCCAGG + Intergenic
1029253331 7:99252283-99252305 CTCCCTCACTCCCGGGTCTCGGG + Intergenic
1030111774 7:106032735-106032757 CTGCCTCACCCTAAATTCTATGG + Exonic
1031012455 7:116538007-116538029 CAGCCCCACCCCAGGGTCTCTGG - Intronic
1032017190 7:128387817-128387839 CTGCCCCACTCCGGGTTCCCTGG + Intergenic
1033036770 7:137882685-137882707 TTCCCTCACTCCAGGTGCTCAGG + Intronic
1033356129 7:140601772-140601794 CTCCCGCCTCCCAGGTTCTCAGG + Exonic
1033534809 7:142301956-142301978 ATGCATCACACCAGGTTCACAGG - Intergenic
1034255853 7:149724349-149724371 CTGACTCAACCCAGCTGCTCAGG - Intronic
1034466681 7:151233894-151233916 CTCATTGACCCCAGGTTCTCTGG + Exonic
1036707564 8:11056574-11056596 CTGTCTGACCCCAGCTTCCCCGG + Intronic
1037110636 8:15160782-15160804 CTGCATCCTCCCAGGTGCTCAGG + Intronic
1037152501 8:15655089-15655111 GTCCCTCACCCCAGGATGTCAGG + Intronic
1037960281 8:23092674-23092696 CAGCCTCCCCCGGGGTTCTCTGG + Intronic
1039793578 8:40894241-40894263 CTGCACCACTCCAGGTGCTCTGG + Intronic
1043588479 8:81797578-81797600 CAGCCTCACCTCTGGTGCTCAGG + Intergenic
1044084010 8:87921282-87921304 GGGGCTCACCCCAGATTCTCAGG + Intergenic
1046779118 8:118196177-118196199 CTGCCTCCGCTCAGGGTCTCAGG - Intronic
1047779890 8:128102521-128102543 TTGCCTCACCTCTGGTGCTCCGG + Intergenic
1049036106 8:140077513-140077535 CTGCCTCAGCCCTGGGGCTCAGG - Intronic
1049164122 8:141116223-141116245 CTGCATCAGCCCAGGTCCTCGGG - Intergenic
1049513886 8:143043505-143043527 CTGCCACAACCCTGGTTCCCTGG - Intronic
1051228605 9:14929655-14929677 CAGCCCCACTCCTGGTTCTCAGG + Intergenic
1051893261 9:21965003-21965025 GTGCCACACCCCAAGTACTCTGG - Intronic
1052747080 9:32451487-32451509 ATGCCCCTCCCCAGGTTCTTAGG - Exonic
1055296688 9:74840496-74840518 CTGCCTCACCCCAGGTTCTCTGG - Intronic
1059251417 9:112890609-112890631 CGGGCTCAACCCAGGTCCTCGGG + Exonic
1059442431 9:114316328-114316350 CCTCCTCACCCCAGCTTGTCTGG + Intergenic
1061043467 9:128152449-128152471 GTGCCCCACCCCAGGGTCTATGG + Intronic
1061178751 9:129012081-129012103 CTGCCCCTCCCCAGTGTCTCAGG + Intronic
1061384956 9:130284358-130284380 CTGCCTCACCTCTGCTTCCCTGG + Intergenic
1061393660 9:130331711-130331733 CTGCCTCGCCCCAGCATCCCTGG - Intronic
1061399840 9:130362237-130362259 CTCCCTCACCCTAAGTTCCCAGG - Intronic
1061724556 9:132575004-132575026 CTGCCTCGGCCCAGGTCCTGGGG - Intergenic
1061730675 9:132611523-132611545 CTTCCTCTCCCCAGGACCTCTGG + Intronic
1062150998 9:135018991-135019013 GGGCCTCAGCCCAGGATCTCTGG - Intergenic
1062178328 9:135176591-135176613 CTGCCCCACCCCAGCATCTGCGG + Intergenic
1062289914 9:135789829-135789851 CTGCCCCACCCCAGGCCCTCAGG + Intronic
1062697236 9:137881635-137881657 CTCCCTCAGCCCAGCTTCCCGGG + Intronic
1186682462 X:11890354-11890376 CTGCCTTTCCCAAGGTTCCCAGG + Intergenic
1188852661 X:35150903-35150925 CTCCCTAACCACAGCTTCTCTGG + Intergenic
1189048417 X:37618093-37618115 CTGCCACACCCAAGATTCTCTGG + Intronic
1189282747 X:39830382-39830404 CTCCCTCACCCCCGCTCCTCTGG - Intergenic
1190378886 X:49818638-49818660 CTAGCTCACACTAGGTTCTCAGG + Intergenic
1192213615 X:69142972-69142994 CTGCCTCAGCCCCGCCTCTCGGG - Intergenic
1192419380 X:71015353-71015375 CTGCCTAACCTTCGGTTCTCAGG - Intergenic
1192460713 X:71314674-71314696 CTGCCTCCTCCCAGGTTCCAGGG - Intergenic
1192629788 X:72768473-72768495 CTTACTCAACACAGGTTCTCTGG + Intergenic
1192651922 X:72952331-72952353 CTTACTCAACACAGGTTCTCTGG - Intergenic
1193516986 X:82478262-82478284 CTGCCTCCCTCCAGATCCTCAGG + Intergenic
1193731753 X:85110442-85110464 CAGCCTCATCCAAAGTTCTCTGG - Intergenic
1195879526 X:109577967-109577989 TCTCCCCACCCCAGGTTCTCAGG - Intergenic
1196722008 X:118863255-118863277 CTGCCTCCTCCCAGGGTTTCAGG - Intergenic
1197701718 X:129604862-129604884 CTGCCTCACCCCAGTTTTCTGGG + Intergenic
1197848787 X:130834231-130834253 CTGCCTCCTCTCAGGTACTCAGG + Intronic
1199987312 X:152962089-152962111 ATGCCTCTCCCCAGGTTCTTTGG - Intronic
1200097444 X:153670823-153670845 CAGCCTTTCCCCAGGATCTCTGG - Exonic
1200759665 Y:7026320-7026342 CTGCCTCACCCCTGGGAATCAGG + Intronic
1202585353 Y:26418638-26418660 CTGCCTCACCACAAGAACTCTGG - Intergenic