ID: 1055297672

View in Genome Browser
Species Human (GRCh38)
Location 9:74850931-74850953
Sequence CAAATAATGATTCATCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055297671_1055297672 13 Left 1055297671 9:74850895-74850917 CCTTCAAAATGAAGCAGCATCTA 0: 1
1: 0
2: 2
3: 14
4: 240
Right 1055297672 9:74850931-74850953 CAAATAATGATTCATCTGCCTGG No data
1055297670_1055297672 14 Left 1055297670 9:74850894-74850916 CCCTTCAAAATGAAGCAGCATCT 0: 1
1: 0
2: 1
3: 24
4: 281
Right 1055297672 9:74850931-74850953 CAAATAATGATTCATCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055297672 Original CRISPR CAAATAATGATTCATCTGCC TGG Intronic
No off target data available for this crispr