ID: 1055306002

View in Genome Browser
Species Human (GRCh38)
Location 9:74929690-74929712
Sequence CTACTGCACAGCCCTTGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055306002_1055306005 14 Left 1055306002 9:74929690-74929712 CCAAAACAAGGGCTGTGCAGTAG No data
Right 1055306005 9:74929727-74929749 TAGACAGAATTGAGCAGGCATGG No data
1055306002_1055306004 9 Left 1055306002 9:74929690-74929712 CCAAAACAAGGGCTGTGCAGTAG No data
Right 1055306004 9:74929722-74929744 GCAACTAGACAGAATTGAGCAGG No data
1055306002_1055306006 23 Left 1055306002 9:74929690-74929712 CCAAAACAAGGGCTGTGCAGTAG No data
Right 1055306006 9:74929736-74929758 TTGAGCAGGCATGGAGAATGTGG No data
1055306002_1055306008 25 Left 1055306002 9:74929690-74929712 CCAAAACAAGGGCTGTGCAGTAG No data
Right 1055306008 9:74929738-74929760 GAGCAGGCATGGAGAATGTGGGG No data
1055306002_1055306007 24 Left 1055306002 9:74929690-74929712 CCAAAACAAGGGCTGTGCAGTAG No data
Right 1055306007 9:74929737-74929759 TGAGCAGGCATGGAGAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055306002 Original CRISPR CTACTGCACAGCCCTTGTTT TGG (reversed) Intergenic
No off target data available for this crispr