ID: 1055306004

View in Genome Browser
Species Human (GRCh38)
Location 9:74929722-74929744
Sequence GCAACTAGACAGAATTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055306001_1055306004 10 Left 1055306001 9:74929689-74929711 CCCAAAACAAGGGCTGTGCAGTA No data
Right 1055306004 9:74929722-74929744 GCAACTAGACAGAATTGAGCAGG No data
1055306000_1055306004 11 Left 1055306000 9:74929688-74929710 CCCCAAAACAAGGGCTGTGCAGT No data
Right 1055306004 9:74929722-74929744 GCAACTAGACAGAATTGAGCAGG No data
1055306002_1055306004 9 Left 1055306002 9:74929690-74929712 CCAAAACAAGGGCTGTGCAGTAG No data
Right 1055306004 9:74929722-74929744 GCAACTAGACAGAATTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055306004 Original CRISPR GCAACTAGACAGAATTGAGC AGG Intergenic
No off target data available for this crispr