ID: 1055307371

View in Genome Browser
Species Human (GRCh38)
Location 9:74943688-74943710
Sequence TCTTAGAAGCAGAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055307371_1055307378 14 Left 1055307371 9:74943688-74943710 CCATCCCCATTCTGCTTCTAAGA No data
Right 1055307378 9:74943725-74943747 CTCATTTTCTGAGAATTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055307371 Original CRISPR TCTTAGAAGCAGAATGGGGA TGG (reversed) Intergenic
No off target data available for this crispr