ID: 1055311444

View in Genome Browser
Species Human (GRCh38)
Location 9:74985877-74985899
Sequence CACATTAAAGTCATACTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055311444_1055311449 28 Left 1055311444 9:74985877-74985899 CCCTGTAGTATGACTTTAATGTG No data
Right 1055311449 9:74985928-74985950 CAAGGCACTAAGTAAATGGCAGG No data
1055311444_1055311446 10 Left 1055311444 9:74985877-74985899 CCCTGTAGTATGACTTTAATGTG No data
Right 1055311446 9:74985910-74985932 TATTACACCTGTCATAAACAAGG No data
1055311444_1055311448 24 Left 1055311444 9:74985877-74985899 CCCTGTAGTATGACTTTAATGTG No data
Right 1055311448 9:74985924-74985946 TAAACAAGGCACTAAGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055311444 Original CRISPR CACATTAAAGTCATACTACA GGG (reversed) Intronic