ID: 1055311444 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:74985877-74985899 |
Sequence | CACATTAAAGTCATACTACA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1055311444_1055311449 | 28 | Left | 1055311444 | 9:74985877-74985899 | CCCTGTAGTATGACTTTAATGTG | No data | ||
Right | 1055311449 | 9:74985928-74985950 | CAAGGCACTAAGTAAATGGCAGG | No data | ||||
1055311444_1055311446 | 10 | Left | 1055311444 | 9:74985877-74985899 | CCCTGTAGTATGACTTTAATGTG | No data | ||
Right | 1055311446 | 9:74985910-74985932 | TATTACACCTGTCATAAACAAGG | No data | ||||
1055311444_1055311448 | 24 | Left | 1055311444 | 9:74985877-74985899 | CCCTGTAGTATGACTTTAATGTG | No data | ||
Right | 1055311448 | 9:74985924-74985946 | TAAACAAGGCACTAAGTAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1055311444 | Original CRISPR | CACATTAAAGTCATACTACA GGG (reversed) | Intronic | ||