ID: 1055311445

View in Genome Browser
Species Human (GRCh38)
Location 9:74985878-74985900
Sequence TCACATTAAAGTCATACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055311445_1055311448 23 Left 1055311445 9:74985878-74985900 CCTGTAGTATGACTTTAATGTGA No data
Right 1055311448 9:74985924-74985946 TAAACAAGGCACTAAGTAAATGG No data
1055311445_1055311449 27 Left 1055311445 9:74985878-74985900 CCTGTAGTATGACTTTAATGTGA No data
Right 1055311449 9:74985928-74985950 CAAGGCACTAAGTAAATGGCAGG No data
1055311445_1055311446 9 Left 1055311445 9:74985878-74985900 CCTGTAGTATGACTTTAATGTGA No data
Right 1055311446 9:74985910-74985932 TATTACACCTGTCATAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055311445 Original CRISPR TCACATTAAAGTCATACTAC AGG (reversed) Intronic