ID: 1055316628

View in Genome Browser
Species Human (GRCh38)
Location 9:75040412-75040434
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055316628_1055316631 27 Left 1055316628 9:75040412-75040434 CCCATTGGGAAAGCAAAACTAGA No data
Right 1055316631 9:75040462-75040484 TGTTAAAACAGTATGGATTAAGG No data
1055316628_1055316632 30 Left 1055316628 9:75040412-75040434 CCCATTGGGAAAGCAAAACTAGA No data
Right 1055316632 9:75040465-75040487 TAAAACAGTATGGATTAAGGAGG No data
1055316628_1055316630 20 Left 1055316628 9:75040412-75040434 CCCATTGGGAAAGCAAAACTAGA No data
Right 1055316630 9:75040455-75040477 AATTTAGTGTTAAAACAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055316628 Original CRISPR TCTAGTTTTGCTTTCCCAAT GGG (reversed) Intergenic