ID: 1055316629

View in Genome Browser
Species Human (GRCh38)
Location 9:75040413-75040435
Sequence TTCTAGTTTTGCTTTCCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055316629_1055316633 30 Left 1055316629 9:75040413-75040435 CCATTGGGAAAGCAAAACTAGAA No data
Right 1055316633 9:75040466-75040488 AAAACAGTATGGATTAAGGAGGG No data
1055316629_1055316631 26 Left 1055316629 9:75040413-75040435 CCATTGGGAAAGCAAAACTAGAA No data
Right 1055316631 9:75040462-75040484 TGTTAAAACAGTATGGATTAAGG No data
1055316629_1055316632 29 Left 1055316629 9:75040413-75040435 CCATTGGGAAAGCAAAACTAGAA No data
Right 1055316632 9:75040465-75040487 TAAAACAGTATGGATTAAGGAGG No data
1055316629_1055316630 19 Left 1055316629 9:75040413-75040435 CCATTGGGAAAGCAAAACTAGAA No data
Right 1055316630 9:75040455-75040477 AATTTAGTGTTAAAACAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055316629 Original CRISPR TTCTAGTTTTGCTTTCCCAA TGG (reversed) Intergenic