ID: 1055316630

View in Genome Browser
Species Human (GRCh38)
Location 9:75040455-75040477
Sequence AATTTAGTGTTAAAACAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055316628_1055316630 20 Left 1055316628 9:75040412-75040434 CCCATTGGGAAAGCAAAACTAGA No data
Right 1055316630 9:75040455-75040477 AATTTAGTGTTAAAACAGTATGG No data
1055316629_1055316630 19 Left 1055316629 9:75040413-75040435 CCATTGGGAAAGCAAAACTAGAA No data
Right 1055316630 9:75040455-75040477 AATTTAGTGTTAAAACAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055316630 Original CRISPR AATTTAGTGTTAAAACAGTA TGG Intergenic