ID: 1055316633

View in Genome Browser
Species Human (GRCh38)
Location 9:75040466-75040488
Sequence AAAACAGTATGGATTAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055316629_1055316633 30 Left 1055316629 9:75040413-75040435 CCATTGGGAAAGCAAAACTAGAA No data
Right 1055316633 9:75040466-75040488 AAAACAGTATGGATTAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055316633 Original CRISPR AAAACAGTATGGATTAAGGA GGG Intergenic