ID: 1055319464 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:75068189-75068211 |
| Sequence | AGATTTATAGGGTGTGATGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1055319464_1055319469 | 7 | Left | 1055319464 | 9:75068189-75068211 | CCAACATCACACCCTATAAATCT | No data | ||
| Right | 1055319469 | 9:75068219-75068241 | TCCATTCTCCACACAGCCAGAGG | No data | ||||
| 1055319464_1055319471 | 8 | Left | 1055319464 | 9:75068189-75068211 | CCAACATCACACCCTATAAATCT | No data | ||
| Right | 1055319471 | 9:75068220-75068242 | CCATTCTCCACACAGCCAGAGGG | No data | ||||
| 1055319464_1055319472 | 9 | Left | 1055319464 | 9:75068189-75068211 | CCAACATCACACCCTATAAATCT | No data | ||
| Right | 1055319472 | 9:75068221-75068243 | CATTCTCCACACAGCCAGAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1055319464 | Original CRISPR | AGATTTATAGGGTGTGATGT TGG (reversed) | Intronic | ||