ID: 1055319464

View in Genome Browser
Species Human (GRCh38)
Location 9:75068189-75068211
Sequence AGATTTATAGGGTGTGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055319464_1055319471 8 Left 1055319464 9:75068189-75068211 CCAACATCACACCCTATAAATCT No data
Right 1055319471 9:75068220-75068242 CCATTCTCCACACAGCCAGAGGG No data
1055319464_1055319469 7 Left 1055319464 9:75068189-75068211 CCAACATCACACCCTATAAATCT No data
Right 1055319469 9:75068219-75068241 TCCATTCTCCACACAGCCAGAGG No data
1055319464_1055319472 9 Left 1055319464 9:75068189-75068211 CCAACATCACACCCTATAAATCT No data
Right 1055319472 9:75068221-75068243 CATTCTCCACACAGCCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055319464 Original CRISPR AGATTTATAGGGTGTGATGT TGG (reversed) Intronic