ID: 1055319469

View in Genome Browser
Species Human (GRCh38)
Location 9:75068219-75068241
Sequence TCCATTCTCCACACAGCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055319466_1055319469 -5 Left 1055319466 9:75068201-75068223 CCTATAAATCTATCCTCCTCCAT No data
Right 1055319469 9:75068219-75068241 TCCATTCTCCACACAGCCAGAGG No data
1055319464_1055319469 7 Left 1055319464 9:75068189-75068211 CCAACATCACACCCTATAAATCT No data
Right 1055319469 9:75068219-75068241 TCCATTCTCCACACAGCCAGAGG No data
1055319463_1055319469 30 Left 1055319463 9:75068166-75068188 CCAGTTCTACTGAGTGCGGGCGT No data
Right 1055319469 9:75068219-75068241 TCCATTCTCCACACAGCCAGAGG No data
1055319465_1055319469 -4 Left 1055319465 9:75068200-75068222 CCCTATAAATCTATCCTCCTCCA No data
Right 1055319469 9:75068219-75068241 TCCATTCTCCACACAGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055319469 Original CRISPR TCCATTCTCCACACAGCCAG AGG Intronic