ID: 1055319471

View in Genome Browser
Species Human (GRCh38)
Location 9:75068220-75068242
Sequence CCATTCTCCACACAGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055319465_1055319471 -3 Left 1055319465 9:75068200-75068222 CCCTATAAATCTATCCTCCTCCA 0: 1
1: 0
2: 0
3: 14
4: 187
Right 1055319471 9:75068220-75068242 CCATTCTCCACACAGCCAGAGGG No data
1055319466_1055319471 -4 Left 1055319466 9:75068201-75068223 CCTATAAATCTATCCTCCTCCAT 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1055319471 9:75068220-75068242 CCATTCTCCACACAGCCAGAGGG No data
1055319464_1055319471 8 Left 1055319464 9:75068189-75068211 CCAACATCACACCCTATAAATCT 0: 1
1: 0
2: 1
3: 17
4: 204
Right 1055319471 9:75068220-75068242 CCATTCTCCACACAGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055319471 Original CRISPR CCATTCTCCACACAGCCAGA GGG Intronic
No off target data available for this crispr