ID: 1055321746

View in Genome Browser
Species Human (GRCh38)
Location 9:75088820-75088842
Sequence TCGGAAGCCAGGCTCGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 335}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055321746_1055321761 27 Left 1055321746 9:75088820-75088842 CCGGCCCCGAGCCTGGCTTCCGA 0: 1
1: 0
2: 1
3: 24
4: 335
Right 1055321761 9:75088870-75088892 TAGTTTTGCGTTCGCTGTTACGG 0: 1
1: 0
2: 0
3: 2
4: 70
1055321746_1055321756 -2 Left 1055321746 9:75088820-75088842 CCGGCCCCGAGCCTGGCTTCCGA 0: 1
1: 0
2: 1
3: 24
4: 335
Right 1055321756 9:75088841-75088863 GAGATCGGCCCCACCGGGATGGG 0: 1
1: 0
2: 0
3: 1
4: 43
1055321746_1055321752 -8 Left 1055321746 9:75088820-75088842 CCGGCCCCGAGCCTGGCTTCCGA 0: 1
1: 0
2: 1
3: 24
4: 335
Right 1055321752 9:75088835-75088857 GCTTCCGAGATCGGCCCCACCGG 0: 1
1: 0
2: 0
3: 0
4: 37
1055321746_1055321762 30 Left 1055321746 9:75088820-75088842 CCGGCCCCGAGCCTGGCTTCCGA 0: 1
1: 0
2: 1
3: 24
4: 335
Right 1055321762 9:75088873-75088895 TTTTGCGTTCGCTGTTACGGAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1055321746_1055321755 -3 Left 1055321746 9:75088820-75088842 CCGGCCCCGAGCCTGGCTTCCGA 0: 1
1: 0
2: 1
3: 24
4: 335
Right 1055321755 9:75088840-75088862 CGAGATCGGCCCCACCGGGATGG 0: 1
1: 0
2: 0
3: 1
4: 43
1055321746_1055321753 -7 Left 1055321746 9:75088820-75088842 CCGGCCCCGAGCCTGGCTTCCGA 0: 1
1: 0
2: 1
3: 24
4: 335
Right 1055321753 9:75088836-75088858 CTTCCGAGATCGGCCCCACCGGG 0: 1
1: 0
2: 0
3: 5
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055321746 Original CRISPR TCGGAAGCCAGGCTCGGGGC CGG (reversed) Intronic
900334197 1:2153416-2153438 TCGCCAGCCATGCTCGGGGCTGG + Intronic
900542492 1:3210407-3210429 TCAGAAGCCAGGCTCCCAGCTGG + Intronic
900587855 1:3442065-3442087 ATGGCAGGCAGGCTCGGGGCTGG - Intergenic
901240830 1:7692240-7692262 TCTGAAGGCAGCCTCAGGGCAGG - Intronic
901611068 1:10498614-10498636 TTGGAGGCCAGGATCGAGGCAGG - Intronic
901633679 1:10659849-10659871 GCGGGAGCCAGGCTGGGGGTGGG + Exonic
903189485 1:21648872-21648894 TGGGAAGCCAGGCCTGGGGTGGG - Intronic
904360037 1:29965300-29965322 TTGAAGGCCAGGCTCTGGGCTGG + Intergenic
904430170 1:30459289-30459311 TTGGCAGCCAGGCTGGGGGAGGG - Intergenic
905115891 1:35640768-35640790 TAGAGAGCCAGGCTCTGGGCAGG + Intronic
905969590 1:42131482-42131504 TGGGAAGCCAGGCCAGGGACTGG - Intergenic
906760134 1:48369488-48369510 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
907289950 1:53407277-53407299 GAGGAGGCCAGGCTGGGGGCAGG + Intergenic
908898112 1:68923905-68923927 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
910311602 1:85830509-85830531 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
911152131 1:94606094-94606116 TCGGAAGCAAGGCGATGGGCTGG - Intergenic
912447408 1:109748505-109748527 GCGGCAGCCAGGCTTGGGGAGGG - Intronic
914876937 1:151519085-151519107 TTGGAGGCCAGGCCCGGGGTCGG + Exonic
914903962 1:151728876-151728898 ACGGAATCCAGCCTCGGGGTGGG + Exonic
915141778 1:153772498-153772520 CCTGGAGCCAGGCTGGGGGCAGG + Intronic
918423540 1:184386931-184386953 GCGGGAGCTAGGCTCGGGGAGGG + Intergenic
920179813 1:204125710-204125732 TCAGAAAGCAGGCTGGGGGCAGG + Intronic
920349503 1:205328590-205328612 TTGGGAGCCAGGCACGGGGAAGG - Intergenic
920359729 1:205406418-205406440 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
920506354 1:206518093-206518115 TGAGAAGTGAGGCTCGGGGCAGG + Intronic
1063095164 10:2902754-2902776 TCGGAACCCAAGCTCAGAGCGGG - Intergenic
1064761691 10:18627812-18627834 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1064922182 10:20531404-20531426 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1065276898 10:24094946-24094968 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
1066152856 10:32642357-32642379 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
1067301495 10:45014757-45014779 TCGGCAGCAAGGCTGGGGGAGGG - Intergenic
1071891351 10:90011474-90011496 GCGGCAGCGAGGCTCGGGGAGGG + Intergenic
1072571181 10:96658621-96658643 TCAGATGCCAGGCTCTGGGACGG - Intronic
1072859079 10:98983926-98983948 GCAGCAGCCAGGCTCGGGGAGGG + Intronic
1073022241 10:100454874-100454896 GCGGCAGCAAGGCTGGGGGCAGG + Intergenic
1075259284 10:120949130-120949152 CCGGACTCCAGGCTCGGAGCAGG + Intergenic
1075870452 10:125769370-125769392 TCGAATGCCAGGGTCGGGGCTGG - Intronic
1076916537 10:133425187-133425209 CCCGGAGCCAGGCTCGGAGCTGG - Intergenic
1076936641 10:133569982-133570004 CCCGGAGCCAGGCTCGGAGCTGG - Intergenic
1077231570 11:1460154-1460176 GGCGAAGCGAGGCTCGGGGCAGG - Intronic
1077432760 11:2524176-2524198 ATGGAAGCCAGGCTCGGCGACGG + Intronic
1077673222 11:4175833-4175855 GCGGCAGCGAGGCTGGGGGCGGG - Intergenic
1077788549 11:5412720-5412742 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1078024314 11:7680168-7680190 TCGGATGCCAGTCTCAAGGCTGG - Intergenic
1078514445 11:12009688-12009710 TTGAATGCCAGGCTGGGGGCTGG - Intronic
1078689005 11:13560547-13560569 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1079232313 11:18659210-18659232 GCGGCAGCGAGGCTCGGGGAGGG + Intergenic
1079598680 11:22285224-22285246 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1080059225 11:27939486-27939508 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1080082565 11:28238318-28238340 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
1081427450 11:42940750-42940772 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1083003669 11:59321200-59321222 TGGCAAGCCAGGCTGGGGGAGGG - Intergenic
1083849069 11:65354907-65354929 TCGGGAGCCGGGCTGGGGGCAGG + Exonic
1084148617 11:67277852-67277874 CCGGAGGGCAGGCTTGGGGCAGG + Intronic
1084155305 11:67309908-67309930 CAGGAAGCCAGGGTTGGGGCGGG - Exonic
1084213777 11:67635815-67635837 TCTGGAGGCAGGCTCTGGGCGGG - Intronic
1084215089 11:67642725-67642747 TAGGAAGCTGGGCTCGGGGCAGG + Exonic
1084458420 11:69282606-69282628 CAGGAAGCCAGGCTCAGTGCAGG - Intergenic
1085202160 11:74708345-74708367 TGGGCAGCCTGGTTCGGGGCAGG + Exonic
1085528981 11:77180531-77180553 TGAGAAGCCAGCCTCGGGGAGGG - Intronic
1087114642 11:94512399-94512421 TCGGAAGGCCGGCTGGGGGCGGG + Intergenic
1087451587 11:98330486-98330508 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1087712180 11:101567047-101567069 GCTGAAGTCTGGCTCGGGGCGGG + Intronic
1088004637 11:104926050-104926072 GCGGAAGCCTGGCTGGGGGAGGG - Intergenic
1088879309 11:113961106-113961128 TCGGAGGCCAAGGTTGGGGCGGG - Intergenic
1089216534 11:116837654-116837676 TCTGCAGCCAGGGTCTGGGCTGG + Exonic
1090690333 11:129174346-129174368 GCGGCAGCAAGGCTCGGGGAGGG + Intronic
1090817962 11:130314977-130314999 TCGGGGGCGGGGCTCGGGGCGGG + Intergenic
1094451646 12:30588773-30588795 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1094785995 12:33848547-33848569 GCGGCAGCGAGGCTCGGGGAGGG + Intergenic
1094877962 12:34672662-34672684 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1095388016 12:41672863-41672885 GCGGCAGCTAGGCTCGGGGAGGG + Intergenic
1096605846 12:52766022-52766044 TCTGAGGCCAGGATAGGGGCTGG - Intergenic
1099146120 12:79045208-79045230 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
1099235702 12:80080387-80080409 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1099514813 12:83584685-83584707 GCGGAAGCCAGGCTGGGGGAGGG + Intergenic
1099643213 12:85318021-85318043 GCGGAAGACAGGCTGGGGGAGGG - Intergenic
1100505738 12:95218125-95218147 CCGGTTGCCAGGCTCTGGGCTGG + Intronic
1100563837 12:95775615-95775637 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1102677701 12:114669293-114669315 TCGGAGGCGAGGCTGGGGGTCGG + Intergenic
1103844703 12:123893300-123893322 TCTGAAGCAAGGCATGGGGCCGG + Exonic
1103905695 12:124326292-124326314 CCAGATGCCAGGCCCGGGGCCGG + Exonic
1104333115 12:127866273-127866295 ACGGCAGCCAGGCTGGGGGAGGG + Intergenic
1104442203 12:128802902-128802924 GCGGAAACCAGGATCGGGACGGG + Intronic
1106029762 13:25989582-25989604 TCTGAAGCAAGGCTTTGGGCTGG - Intronic
1108587772 13:51885692-51885714 AAAGAAGCCAGGCTCTGGGCTGG + Intergenic
1112436679 13:99395578-99395600 TGGGCAGCCAGGCTTGGGGCAGG - Intergenic
1113877384 13:113602774-113602796 TCACAAGCCAGGCCCAGGGCAGG - Intronic
1114171844 14:20280465-20280487 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1114502700 14:23182825-23182847 TCCGGAACCAGCCTCGGGGCTGG + Exonic
1114502702 14:23182832-23182854 TCGGACGCCAGCCCCGAGGCTGG - Exonic
1114681900 14:24491848-24491870 TCGGCAGCGAGGCTGGGGGAGGG + Intergenic
1114751558 14:25210124-25210146 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1116042591 14:39703300-39703322 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1116322831 14:43492594-43492616 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1116331081 14:43598318-43598340 GCAGAAGCCAGGCTGGGGGAGGG + Intergenic
1116570396 14:46508977-46508999 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1116667330 14:47795044-47795066 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1117574332 14:57082907-57082929 TTGGAAGCCAGGATCGGGGAGGG - Intergenic
1117577344 14:57112629-57112651 GCGGCAGCGAGGCTCGGGGAGGG + Intergenic
1118780727 14:69005991-69006013 TGGGCAGCCAGGCTGGGCGCTGG + Intergenic
1121615610 14:95311688-95311710 ACGGAAGCCAGGGTTGGGTCGGG - Intronic
1122802385 14:104238158-104238180 TCGGGAGGAAGGCTGGGGGCTGG + Intergenic
1122929312 14:104926126-104926148 TCTGCAGCCAGGCTGGGCGCTGG - Intronic
1124223162 15:27866971-27866993 TCAGCAGCCAGCGTCGGGGCAGG + Intronic
1126493495 15:49265283-49265305 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
1126852247 15:52804552-52804574 TCTGCAGCCAGGCCCGGGGCAGG + Intergenic
1126922255 15:53541047-53541069 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1126933853 15:53684614-53684636 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1128776495 15:70324394-70324416 TGGGACGACAGCCTCGGGGCAGG - Intergenic
1128875066 15:71194963-71194985 TCCGAAGCCCAGCACGGGGCTGG + Intronic
1130403467 15:83578291-83578313 GCTGAAGCCAGGCTGAGGGCAGG - Intronic
1132112110 15:99109197-99109219 TCTGAGGCCAGGCCTGGGGCAGG - Intronic
1132335985 15:101049016-101049038 TGAGAAGCCAGGCTGGGGACAGG + Intronic
1132641853 16:981702-981724 TGGGTAGCCGGGCGCGGGGCGGG + Intergenic
1132679133 16:1132594-1132616 GCGGAGGCCAGGCTGGGGCCGGG + Intergenic
1132807008 16:1779502-1779524 TCGAAAGCCAGCTTCAGGGCAGG + Intronic
1134447496 16:14342057-14342079 TTGGAAGCCAGGCCAGGGACAGG + Intergenic
1136070615 16:27784873-27784895 ACGGCAGCCAGGCCTGGGGCGGG + Intergenic
1136615049 16:31393449-31393471 TGGGAGGGCAGGCTGGGGGCTGG + Intronic
1136745660 16:32587958-32587980 GCGGCAGCGAGGCTCGGGGAGGG - Intergenic
1136926561 16:34380663-34380685 TAGGAAACCTGGCTAGGGGCAGG + Intergenic
1136978013 16:35031144-35031166 TAGGAAACCTGGCTAGGGGCAGG - Intergenic
1137350840 16:47712785-47712807 TGGGTGGCCAGGCTCCGGGCAGG - Intergenic
1137564530 16:49524862-49524884 CCGGCAGCCAGTCTGGGGGCTGG + Intronic
1139468114 16:67164852-67164874 GAGGAAGGCAGGCACGGGGCTGG - Exonic
1139505425 16:67396022-67396044 TCGGCAGCCTGGATCGTGGCTGG - Intronic
1139851708 16:69954391-69954413 CCGGACGCCAGGCTCGGGGTTGG - Exonic
1139880683 16:70177298-70177320 CCGGACGCCAGGCTCGGGGTTGG - Exonic
1140054137 16:71510890-71510912 GCGGCAGCAAGGCTCGGGGAGGG - Intronic
1140097164 16:71884471-71884493 TAAGAAACCAGGATCGGGGCTGG - Intronic
1140173091 16:72627692-72627714 TCGGCAGCGAGGCTGGGGGAGGG + Intergenic
1140371826 16:74418219-74418241 CCGGACGCCAGGCTCGGGGTTGG + Exonic
1140715475 16:77722380-77722402 TCGGAGGCCGGGATCGGGGCGGG - Intergenic
1141047340 16:80727502-80727524 GTGGAAGCGAGGCTCGGGGAGGG + Intronic
1141442895 16:84040892-84040914 TCCTAGGCCAGGCACGGGGCAGG + Intronic
1141895951 16:86958908-86958930 TTGGAACCAAGGCTAGGGGCAGG - Intergenic
1141986345 16:87582749-87582771 TCCGAGGCCAGGCTGCGGGCAGG + Intergenic
1203047788 16_KI270728v1_random:847163-847185 GCGGCAGCGAGGCTCGGGGAGGG - Intergenic
1142508191 17:379223-379245 TCGGCAGCCTGTCTCGGGGTGGG - Intronic
1142623599 17:1179545-1179567 TCGGGACCCAGGCACCGGGCTGG - Intronic
1142639748 17:1279159-1279181 TCGGGAGCCAGGCTTTGGCCTGG + Intergenic
1143250247 17:5518182-5518204 TGGGAAGACAGGCTTTGGGCTGG - Intronic
1143518789 17:7433898-7433920 TCGGAAGCCACCCTCTGGGAAGG + Intergenic
1143636092 17:8164375-8164397 TGGGAAGCCAGGGTGGGGGAGGG - Intergenic
1144286843 17:13785359-13785381 TGAGAAGCCAGGCCTGGGGCTGG + Intergenic
1145034826 17:19533775-19533797 CCGGGCGCCAGGCGCGGGGCGGG + Intronic
1145942383 17:28749415-28749437 CCAGAAGCCAGGCACGTGGCGGG + Exonic
1146577908 17:34011308-34011330 TGGGAAGCAAGGCTGGGGGCAGG - Intronic
1147167592 17:38601780-38601802 TGAGAAGCCAAGCTGGGGGCGGG - Intronic
1148749425 17:49935935-49935957 GCGGAGGACAGGCTGGGGGCTGG - Intergenic
1148874999 17:50681865-50681887 GGGGAAGCCAGGCTGGGGTCAGG - Intronic
1149994415 17:61399383-61399405 TCGGAGGCCAGGCTGGGGCTCGG + Intergenic
1152183459 17:78840087-78840109 TCCGCGGCCGGGCTCGGGGCAGG - Intronic
1152396424 17:80036064-80036086 GGGGACGCCAGGCTCGGGACGGG - Intergenic
1152565953 17:81100568-81100590 TGGGGACCCAGGCTTGGGGCTGG - Intronic
1152757329 17:82092469-82092491 CCCGGAGCCAGCCTCGGGGCTGG - Exonic
1153105546 18:1521801-1521823 GCGGCAGCCAGGCTTGGGGAGGG - Intergenic
1154167535 18:12027283-12027305 TGGCAAGCCTGGCTCAGGGCAGG - Intronic
1154315409 18:13300136-13300158 CCGGAAGCCAGGCTGGGGCATGG - Intronic
1155032224 18:21994629-21994651 TGGGAAGCCAGGATTGGGGCTGG - Intergenic
1155597968 18:27510427-27510449 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1155675290 18:28422129-28422151 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1156678963 18:39566010-39566032 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1156785607 18:40910284-40910306 TCAGAAGCTAGGCTGGGGGAAGG - Intergenic
1157516405 18:48314819-48314841 ATGAAAGCCAGGGTCGGGGCGGG - Intronic
1157849122 18:51030686-51030708 TCGGGAGCCCGCCCCGGGGCGGG - Intronic
1158514203 18:58117698-58117720 CCAGAAACCAGGCTGGGGGCAGG - Intronic
1159051213 18:63422617-63422639 GCGGAAGTCGGGCTCGGCGCAGG + Intergenic
1160716310 19:578310-578332 TGGGCGGCCTGGCTCGGGGCAGG + Intronic
1161046053 19:2135649-2135671 TCCGAGGCCAGGCCAGGGGCAGG + Intronic
1161272421 19:3397436-3397458 GCTGCAGCCAGGCTGGGGGCTGG + Intronic
1161737860 19:6002604-6002626 ACCGTGGCCAGGCTCGGGGCAGG + Intronic
1162733825 19:12734700-12734722 TCGGGCGCCAAGCGCGGGGCCGG - Exonic
1163462592 19:17448097-17448119 TCGGAGGCCCGGCTGGGGGCTGG - Intronic
1164591357 19:29509222-29509244 TCGCAAGCCAGGCTCTCAGCAGG - Intergenic
1166334834 19:42099532-42099554 TGGGAAGCCCGGCCCGGGGCTGG + Exonic
926162199 2:10496831-10496853 TCTGAAGCCAAGGTCAGGGCAGG - Intergenic
927283892 2:21336357-21336379 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
930091380 2:47533855-47533877 TCCGAAGCCAGGCGTGGGGTGGG + Intronic
930803063 2:55462564-55462586 GCGGCAGCCTGGCTCGGGGAGGG + Intergenic
930972927 2:57419125-57419147 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
930987594 2:57609254-57609276 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
931818648 2:65929902-65929924 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
931846224 2:66206736-66206758 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
931864163 2:66391547-66391569 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
932990603 2:76781340-76781362 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
932991705 2:76796221-76796243 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
933579014 2:84104053-84104075 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
935384531 2:102486773-102486795 TCGGATGCCTGGCACAGGGCAGG + Intronic
937226829 2:120375074-120375096 CCTGAAGACAGGCTTGGGGCTGG + Intergenic
937980109 2:127609749-127609771 TCACACCCCAGGCTCGGGGCTGG - Intronic
939924334 2:148154519-148154541 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
940720746 2:157279532-157279554 GCGGCAGCCTGGCTCGGGGAGGG - Intronic
942723628 2:178982869-178982891 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
942731639 2:179066885-179066907 TCGGCAGCAAGGCTGGGGGAGGG - Intergenic
943549328 2:189319599-189319621 GCAGCAGCCAGGCTCGGGGAGGG + Intergenic
945822705 2:214684190-214684212 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
946019983 2:216634109-216634131 GCGGAAGTCAGGCCCGGGGAGGG + Intronic
946360983 2:219219159-219219181 ACGGAATCGTGGCTCGGGGCTGG + Intronic
946360990 2:219219193-219219215 ACGGAATCCTGGCTCGGGGCAGG + Intronic
947215512 2:227746222-227746244 TGGGAACCCAGCCTCTGGGCAGG + Intergenic
947722341 2:232377833-232377855 CAGGAAGCCAGGCGGGGGGCAGG + Intergenic
948132381 2:235610141-235610163 TCAGAAGCCAGGAGCTGGGCTGG - Intronic
948462372 2:238136357-238136379 TCGGAAGCCTGGCCTGGGGCGGG + Intergenic
1171122506 20:22579030-22579052 TCGGAACCCGGGCTAGGGGAGGG + Intergenic
1172843905 20:37918280-37918302 TCGGAAGCCAGGGCTGGTGCTGG + Intronic
1172903832 20:38354496-38354518 TCGGAGGCCAGGCTGAGCGCTGG - Intronic
1173059700 20:39650002-39650024 GCCTAAGCCAGGCTCTGGGCTGG - Intergenic
1174789247 20:53462512-53462534 TCTGAAGCCAGGGCTGGGGCAGG - Intronic
1175248033 20:57593050-57593072 TGGGAAACCAGGCACGGGGTGGG + Intergenic
1175644338 20:60658388-60658410 TGGGAACCCAGGCTTAGGGCTGG + Intergenic
1178639244 21:34332939-34332961 TCAGAAGCCAGGCCTGGGGCAGG + Intergenic
1179930507 21:44568290-44568312 TCGGCAGCCAGGCACTGTGCAGG + Intronic
1180092856 21:45541884-45541906 GCGGAGGGCAGGCTGGGGGCCGG + Intronic
1180737825 22:18031818-18031840 CAGGAAGCCACGCTGGGGGCAGG - Intergenic
1180885350 22:19239651-19239673 TCGGCATCCAGGCCCGGGGAGGG - Intronic
1180962853 22:19770137-19770159 TCTGCAGCCAGGCTAGGGGAGGG - Intronic
1182165022 22:28164078-28164100 GCGGAAGCGAGGCTGGGGGAGGG + Intronic
1182209594 22:28663701-28663723 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1182622094 22:31623880-31623902 TCAGTGGCCAGGCTCTGGGCAGG + Intronic
1182809754 22:33105755-33105777 TCTTAAGCCAGGCTGGGAGCAGG + Intergenic
1183007311 22:34914103-34914125 TCTGGAGCCAGCCTCTGGGCTGG + Intergenic
1183347623 22:37316638-37316660 TTGGCAGCCAGGCTGGGGACAGG + Intergenic
1184459115 22:44627169-44627191 AAGGAAGCCAGGCAGGGGGCAGG + Intergenic
1184514684 22:44954820-44954842 CTGGAAGACAGGCTCTGGGCAGG + Intronic
1185020772 22:48373642-48373664 TGGGAACCCAGCCACGGGGCTGG + Intergenic
950299874 3:11867712-11867734 GCGGCAGCCAGGCTCGGGGAGGG - Intergenic
951071185 3:18330868-18330890 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
951198879 3:19855466-19855488 TCGGCAGCTAGGCTGGGGGAGGG + Intergenic
951818577 3:26783514-26783536 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
952936907 3:38405813-38405835 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
954290825 3:49649128-49649150 TAGGATGCCAGGCTAAGGGCAGG + Intronic
955121402 3:56062920-56062942 TCCGAAGCCAGAGTTGGGGCAGG - Intronic
958726347 3:97910335-97910357 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
959353413 3:105296637-105296659 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
959398358 3:105869033-105869055 ACAGGACCCAGGCTCGGGGCGGG + Exonic
959489888 3:106975862-106975884 TCGGCAGCGAGGCTGGGGGAGGG + Intergenic
959891526 3:111561796-111561818 TCGGCAGCGAGGCTGGGGGAGGG - Intronic
960973629 3:123156196-123156218 AAGGAAGCCAGGCTGGGGACAGG + Intronic
968234994 3:197026267-197026289 TCAGAAGCCCGGCTCCGGGTAGG - Intronic
968603280 4:1520395-1520417 GCGGAAGCCAGGCTCGGGGAGGG + Intergenic
969492108 4:7505309-7505331 CGGGGAGCCAGGCACGGGGCTGG + Intronic
969836840 4:9849136-9849158 TAGGAGGCCATGCTTGGGGCAGG + Intronic
970241600 4:14015047-14015069 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
974418967 4:61646864-61646886 TCGGCAGCCAGGCTGGGGGAGGG - Intronic
976263090 4:83164473-83164495 TCGGCAGCGAGGCTGGGGGAGGG + Intergenic
976574765 4:86656932-86656954 GCGGCAGCGAGGCTCGGGGATGG - Intronic
977333248 4:95664120-95664142 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
978677520 4:111337363-111337385 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
979624136 4:122827089-122827111 TCGGAGGCCGGGGCCGGGGCCGG + Exonic
980631934 4:135447954-135447976 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
982033584 4:151325096-151325118 TCAGAGGCCAGACTCGGGGAGGG - Intronic
982838858 4:160156896-160156918 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
985588006 5:750922-750944 GCGGGAGGCAGGCTCGGGGAGGG - Intronic
985602675 5:843389-843411 GCGGGAGGCAGGCTCGGGGAGGG - Intronic
985708095 5:1413338-1413360 CAGAAAGCCAGGGTCGGGGCTGG - Intronic
986101503 5:4615844-4615866 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
988684372 5:33513464-33513486 TAGAAAGCCAGGCTTGGGGCAGG - Intergenic
988999541 5:36745592-36745614 TGGGCAGCCAGGGTTGGGGCAGG + Intergenic
990684726 5:58288466-58288488 GCGGCAGCCAGGCTGGGGGGAGG + Intergenic
990913845 5:60881567-60881589 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
991265670 5:64714627-64714649 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
991949221 5:71931740-71931762 TGGGAACCCAGGCTAGGGGAGGG + Intergenic
994631683 5:102295719-102295741 TTGGAAGGCTGGCTGGGGGCCGG + Intronic
994693557 5:103047157-103047179 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
996625752 5:125568390-125568412 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
997080475 5:130732511-130732533 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
997117257 5:131138622-131138644 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
997232403 5:132254393-132254415 TTGGAATCCAGGCTCTTGGCTGG + Intronic
998092618 5:139380107-139380129 TGGGAGGCCAGGCTGGGGCCAGG + Intronic
998131187 5:139651763-139651785 TAGGAACCCAGGCTTGGGTCTGG - Intronic
998241719 5:140452154-140452176 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1000404590 5:160873939-160873961 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1002312397 5:178322858-178322880 TGGGAAGGCAGGCTGGGGACAGG + Intronic
1006918874 6:37614707-37614729 TTAAAAGCCAGGCTGGGGGCAGG + Intergenic
1006919059 6:37615597-37615619 AGGGAGGCCAGGCTCGGGGCTGG + Intergenic
1007701986 6:43771045-43771067 TCGGAAGCCGGGCTCATGGACGG + Exonic
1008183522 6:48363508-48363530 GCGGCAGCCAGGCTGGGGGAAGG + Intergenic
1008218422 6:48824553-48824575 TGGGAAGCCGGGCGGGGGGCGGG + Intergenic
1008472144 6:51896072-51896094 TCGGTAGCCAGGCTGGAGGAGGG + Intronic
1010137306 6:72570555-72570577 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1010679610 6:78783547-78783569 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1011397134 6:86921584-86921606 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1012285431 6:97382266-97382288 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1013197702 6:107860307-107860329 GCGGCAGCCAGGCACGGGGAGGG - Intergenic
1014357697 6:120433006-120433028 GCGGCAGCGAGGCTCGGGGAGGG + Intergenic
1017394312 6:153979338-153979360 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1017716536 6:157217398-157217420 TGGGCAGCCAGCCTCGGGGAGGG + Intergenic
1018480216 6:164182427-164182449 AGGGCAGGCAGGCTCGGGGCAGG - Intergenic
1019096926 6:169589381-169589403 AAGGAAGCCAGGCTGAGGGCAGG + Intronic
1019710677 7:2516918-2516940 TCGGAAGGCAGGCTGGGCCCTGG + Intronic
1020140353 7:5608203-5608225 GGGGAAGCCAGGCCAGGGGCCGG + Intergenic
1020438311 7:8189678-8189700 TCGGACTGCAGGCTCGGAGCTGG - Intronic
1021047415 7:15940646-15940668 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1021302598 7:18990635-18990657 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
1022810012 7:33859554-33859576 TAGAAAGCCAGGCTCAGGCCGGG - Intergenic
1023147751 7:37169052-37169074 TCGGCAGCGAGGCTGGGGGAGGG - Intronic
1023881806 7:44325168-44325190 CAGGCAGCCAGGCCCGGGGCCGG + Intronic
1024981199 7:55159010-55159032 TCTGACCCCAGGCTGGGGGCTGG - Intronic
1027267677 7:76503275-76503297 TTGGAAGCCAGTTTCCGGGCAGG + Intronic
1027319489 7:77003138-77003160 TTGGAAGCCAGTTTCCGGGCAGG + Intergenic
1027639264 7:80713524-80713546 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1028114494 7:86982088-86982110 GCGGCAGCCTGGCTCGGGGAGGG + Intronic
1029477032 7:100791314-100791336 TGGGAAGGCAGGCTGAGGGCAGG - Intronic
1030792175 7:113743318-113743340 GCGGAAGCGAGGCTGGGGGAGGG + Intergenic
1032255601 7:130294884-130294906 TGGGAAGCCAGGCTCTGGATTGG + Intronic
1033324219 7:140363846-140363868 TGGGAAGGCAGGCTGGGGCCAGG + Intronic
1033641164 7:143264169-143264191 TAGGAAGGGAGGGTCGGGGCAGG + Intronic
1035135957 7:156703403-156703425 TCAGAGGCCAGGATGGGGGCTGG + Intronic
1036769550 8:11569621-11569643 TGGGTTGCCAGGCTGGGGGCGGG - Intergenic
1036798450 8:11772321-11772343 TCAGAAGACAGGTTTGGGGCAGG - Intronic
1037308531 8:17530466-17530488 TAGAAAGCCAGGCTGGGGCCAGG + Intronic
1040545064 8:48392607-48392629 TGGGAAGTCAGGCACTGGGCTGG + Intergenic
1042087106 8:65121055-65121077 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1044209647 8:89535648-89535670 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1045450259 8:102317367-102317389 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1046322237 8:112594422-112594444 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1046812604 8:118548956-118548978 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1046879218 8:119290034-119290056 GCGGCAGCCTGGCTCGGGGAGGG - Intergenic
1049656146 8:143798876-143798898 TTGGAATCCAGGGCCGGGGCAGG + Intronic
1049734948 8:144199851-144199873 ACTGCAGCCAGGCTGGGGGCAGG + Intronic
1049899008 9:140067-140089 GCGGCAGCGAGGCTCGGGGAGGG + Intronic
1050047124 9:1558851-1558873 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1051005098 9:12334419-12334441 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1051203913 9:14664413-14664435 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1051458748 9:17290596-17290618 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
1052437142 9:28443877-28443899 TCTGAAGCCTGGGTCTGGGCTGG + Intronic
1053393720 9:37753782-37753804 GCGGAAGCGAGGCCGGGGGCGGG + Intronic
1055321746 9:75088820-75088842 TCGGAAGCCAGGCTCGGGGCCGG - Intronic
1055333489 9:75208216-75208238 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1055860814 9:80747253-80747275 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1057025866 9:91733502-91733524 TGGGATGCCAGGCTGGGGGTGGG - Intronic
1059325937 9:113504035-113504057 TTTGAATCCAGGCCCGGGGCTGG + Intronic
1061570550 9:131475308-131475330 TCAGAGGACAGGCCCGGGGCCGG + Exonic
1061778896 9:132984396-132984418 TCTGAACACAGGCTCGGGCCGGG - Intronic
1061841689 9:133362157-133362179 GAGGGAGGCAGGCTCGGGGCTGG + Exonic
1185455596 X:309053-309075 GCGGAGTCCAGGCTCCGGGCGGG + Intronic
1187223042 X:17348069-17348091 GCGGCAGCGAGGCTGGGGGCGGG - Intergenic
1188123112 X:26334408-26334430 GCGACAGCCAGGCTCGGGGAGGG + Intergenic
1189213093 X:39301207-39301229 TTGCCAGCCAGGCTCTGGGCAGG + Intergenic
1190063250 X:47224069-47224091 TGGGAAGGCAGGCCCAGGGCAGG - Intronic
1190726408 X:53193291-53193313 ACGGGAGTCGGGCTCGGGGCCGG - Exonic
1191704929 X:64084566-64084588 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic
1192954310 X:76052501-76052523 GTGGAAGCCAGGCTGGGGGAGGG - Intergenic
1193045239 X:77046645-77046667 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1193435940 X:81475168-81475190 TCGGCAGCCTGGCTGGGGGAGGG - Intergenic
1195347338 X:103963233-103963255 TCAGACGCCAAGCTCGGAGCTGG - Exonic
1195360104 X:104075608-104075630 TCAGACGCCAAGCTCGGAGCTGG + Intergenic
1195445750 X:104950558-104950580 GCGGCAGCCAGGCTGGGGGAGGG - Intronic
1195517820 X:105797325-105797347 GCGGCAGCCAGGCTTGGGGAGGG + Intergenic
1195639346 X:107156184-107156206 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1197438382 X:126460362-126460384 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1197624120 X:128783072-128783094 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1198581827 X:138073829-138073851 GCGGCAGCCAGGCTGGGGGAGGG + Intergenic
1198643217 X:138778721-138778743 GCGGCAGCCAGGCTGGGGGAGGG + Intronic
1199974644 X:152886055-152886077 CAGTATGCCAGGCTCGGGGCGGG - Intergenic
1200001853 X:153066212-153066234 GCGGAGGACAGGCTAGGGGCAGG + Intergenic
1200005879 X:153083821-153083843 GCGGAGGACAGGCTAGGGGCAGG - Intergenic
1201954956 Y:19613408-19613430 GCGGCAGCCAGGCTAGGGGAGGG + Intergenic
1202014505 Y:20386269-20386291 GCGGCAGCCAGGCTGGGGGAGGG - Intergenic