ID: 1055322665

View in Genome Browser
Species Human (GRCh38)
Location 9:75097678-75097700
Sequence CAAACATAAAAGTCTAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055322660_1055322665 17 Left 1055322660 9:75097638-75097660 CCAGAGTTGGTATTACTGTTATA 0: 1
1: 0
2: 1
3: 9
4: 114
Right 1055322665 9:75097678-75097700 CAAACATAAAAGTCTAATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055322665 Original CRISPR CAAACATAAAAGTCTAATGG GGG Intronic
No off target data available for this crispr