ID: 1055327094

View in Genome Browser
Species Human (GRCh38)
Location 9:75142157-75142179
Sequence GCACTCCCAGTGAGCTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055327094_1055327098 20 Left 1055327094 9:75142157-75142179 CCATGAGAGCTCACTGGGAGTGC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1055327098 9:75142200-75142222 TCCTCATGGATAGATGGAGATGG No data
1055327094_1055327097 14 Left 1055327094 9:75142157-75142179 CCATGAGAGCTCACTGGGAGTGC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1055327097 9:75142194-75142216 AGTAATTCCTCATGGATAGATGG No data
1055327094_1055327096 6 Left 1055327094 9:75142157-75142179 CCATGAGAGCTCACTGGGAGTGC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1055327096 9:75142186-75142208 TTCTTTAAAGTAATTCCTCATGG No data
1055327094_1055327100 21 Left 1055327094 9:75142157-75142179 CCATGAGAGCTCACTGGGAGTGC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1055327100 9:75142201-75142223 CCTCATGGATAGATGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055327094 Original CRISPR GCACTCCCAGTGAGCTCTCA TGG (reversed) Intronic
900159431 1:1216481-1216503 GCTCTCCCAGTGGGAGCTCAGGG - Intergenic
902169991 1:14602186-14602208 GTACTCCCTGTGAGCTGGCATGG + Intronic
902929556 1:19721236-19721258 GCCCTCACAGTGAGCCCTGATGG - Intronic
902994724 1:20215145-20215167 GCACTCCTAGGGGTCTCTCATGG - Intergenic
903369563 1:22826502-22826524 TCTCTCCCAGTGATCTCTCAAGG + Intronic
907525516 1:55051718-55051740 GCAGTCCCCGTGAGCCCTCCTGG + Intronic
910168896 1:84357243-84357265 TCACTCCCAGTGATCTACCAAGG - Intronic
910902308 1:92134217-92134239 GCAATCCCAGGAATCTCTCAAGG - Intronic
912379480 1:109239637-109239659 GCCCTCCCACAGAGCTCTCAGGG - Intergenic
914446536 1:147755448-147755470 CCACTCTCAGGGAGCTCTCCTGG + Intergenic
915596443 1:156899117-156899139 GCACTCCCCGCCATCTCTCAGGG - Intronic
917088449 1:171327846-171327868 GCAGTTACAGTGAGCTCTGATGG + Intronic
919534882 1:198775036-198775058 TCTCTCACAGGGAGCTCTCAGGG + Intergenic
922122985 1:222692348-222692370 GCACTCCTAGCCTGCTCTCACGG + Intronic
1063521894 10:6748731-6748753 GCACTTTCAGTGAGCTCTGTGGG - Intergenic
1074683992 10:115941076-115941098 GCACTCACAGAGAACACTCAGGG - Intronic
1077034423 11:487922-487944 GGGCCCCCAGTGAGGTCTCAGGG - Intronic
1083630075 11:64090845-64090867 GCACTCCCAGGGAGCCCTGAGGG + Intronic
1085520615 11:77137172-77137194 TCACTTCCTGTGACCTCTCAGGG - Intronic
1088745614 11:112801642-112801664 TCACTCCCAGGGAGAACTCAGGG + Intergenic
1089074769 11:115729116-115729138 GGCCTCCCACTGAGCCCTCAAGG - Intergenic
1100404358 12:94260555-94260577 GCCCTGCCAGTGAGCTTCCATGG + Intronic
1102569825 12:113820678-113820700 CCACTCCCACAGAGATCTCAGGG - Intronic
1105673818 13:22648598-22648620 GCACTCCCAGTGTGCTGTTCTGG + Intergenic
1106528478 13:30565326-30565348 GGACTCCTAGTGAGCTGTCAAGG + Intronic
1107939718 13:45372831-45372853 GCTTTCCCTGTGAGTTCTCAGGG + Intergenic
1114454502 14:22846245-22846267 GCCCTCCCACTCAGCCCTCAGGG - Exonic
1115315292 14:32019041-32019063 TCAGTCCCAGTGGTCTCTCATGG + Intergenic
1116020007 14:39448778-39448800 GCACTCCCAGTGAGAGAACAAGG - Intergenic
1118715658 14:68558055-68558077 GCACAGCCTTTGAGCTCTCATGG - Intronic
1120911880 14:89674115-89674137 TGACTCACAGTCAGCTCTCATGG + Intergenic
1123673560 15:22685403-22685425 CCACTCCCAGTGGGCTCTGCTGG - Intergenic
1124325562 15:28758395-28758417 CCACTCCCAGTGGGCTCTGCTGG - Intergenic
1127031051 15:54863426-54863448 GGGTACCCAGTGAGCTCTCAGGG - Intergenic
1128498912 15:68213820-68213842 GTGCTCCCAGTGACATCTCAGGG + Intronic
1131953591 15:97707414-97707436 GGACTCCCAGTGAGTTCCAATGG - Intergenic
1132090764 15:98946505-98946527 GCACACTCAGGGAGCTCTGAGGG + Intronic
1133107816 16:3525043-3525065 GTACTCCCAGTTAGCCCTCCTGG - Intronic
1141593749 16:85085339-85085361 GCAGTGCCAGTGACCTCTCGTGG + Intronic
1144483485 17:15646227-15646249 GCACTCCCAGTTACCTCAAAAGG + Intronic
1144709145 17:17388823-17388845 CCACTCACTGTGTGCTCTCAGGG + Intergenic
1144915202 17:18718800-18718822 GCACTCCCAGTTACCTCAAAAGG - Intronic
1146689195 17:34861422-34861444 CCACTCCCTGGGAGCTCACAGGG - Intergenic
1147669182 17:42166979-42167001 GCACTACCAATGACCTCTTATGG + Intronic
1149379893 17:56082850-56082872 CCTGTCCCAGTGAGCTCTCCAGG + Intergenic
1154375762 18:13808449-13808471 GCCCTCCAGGTGAGCTCCCAGGG + Intergenic
1157157686 18:45283820-45283842 GGGCTTCCAGTGATCTCTCATGG - Intronic
1157748511 18:50158291-50158313 GATCTCCCAATGAGCTCACATGG + Intronic
1160987315 19:1845045-1845067 GCACTCCCTGTGGTGTCTCAGGG - Intronic
1161968108 19:7560262-7560284 GCTATCCCAGTGAGCCCACAAGG - Intronic
1163719934 19:18894183-18894205 GCACTCCCAATGTCCCCTCAGGG - Intronic
1166834290 19:45657849-45657871 GCACTACCAGGGAGCAATCAGGG + Intergenic
1167038223 19:47006806-47006828 TCACTCCCCGTGAGCGCTCCAGG + Intergenic
1168677716 19:58291075-58291097 CCACTCCCAGTGCACTCACAGGG + Intronic
925389652 2:3486519-3486541 GCACGCCCAGGGAGCTGGCAGGG - Intergenic
925580191 2:5402174-5402196 GCACTGCCAATGGGCTCACAGGG + Intergenic
925974233 2:9130051-9130073 GGACGCCCAGTGAGCTCACAGGG - Intergenic
926296678 2:11573993-11574015 GCCCTTCCAGGGAGCTCTGAAGG + Intronic
926595103 2:14781673-14781695 GTACTCTCAGGGAGGTCTCAGGG - Intergenic
927234487 2:20858044-20858066 GCACTTACACTGAGCTCTCCTGG + Intergenic
929054303 2:37862834-37862856 GCACCCCCAGTGCTCCCTCAGGG + Intergenic
937529194 2:122808386-122808408 GGGCACCCAGTGAGCTCCCAGGG - Intergenic
941758212 2:169211684-169211706 GCACTCCTAATAAGCTCCCAGGG - Intronic
942524455 2:176838607-176838629 GCACCCCCAGTCAGCTCACCAGG - Intergenic
943387053 2:187214392-187214414 GCTCTCTCAGTGACCTCTCCTGG - Intergenic
948006200 2:234609841-234609863 GCACTGCCAGTGAGTTCTGCCGG - Intergenic
948070127 2:235114169-235114191 GCACTCCCAGTGCTCTCTGCTGG + Intergenic
948619826 2:239227380-239227402 GCCCTCCCAGTGAGGTCACAGGG + Intronic
1173064990 20:39702215-39702237 GTACTCCCAGAGAGCAATCATGG + Intergenic
1179434329 21:41349965-41349987 GCATGCACAGTGAGCCCTCATGG + Intronic
1179949814 21:44703317-44703339 GCACCTCCAGGCAGCTCTCAGGG + Intronic
1181595056 22:23908709-23908731 GAACCCCCAGTGAACTCTCGGGG - Intergenic
1182668748 22:31978086-31978108 GCACTTCCTCTGAGCTCTCATGG - Intergenic
1183054920 22:35299503-35299525 GCAGTCACAGTGAGGTCCCAAGG + Intronic
1183373377 22:37448316-37448338 TCACTCCCCGTGAGCAGTCAGGG + Intergenic
1184693150 22:46126435-46126457 TCACTCCCTGTGTGATCTCAGGG + Intergenic
1185079823 22:48703515-48703537 ACAGTCCCAGTGAGCTCTGGTGG + Intronic
949988180 3:9555649-9555671 TCCCTGCCGGTGAGCTCTCATGG + Intergenic
951528759 3:23679394-23679416 GCACTCCCAGGGATCCCTCATGG - Intergenic
952982675 3:38750907-38750929 GCACTCCCAGCGAGCCCTGCAGG + Intronic
953995173 3:47513879-47513901 GCCCTCCCAGTGGGCCCCCAAGG + Intergenic
954328295 3:49875593-49875615 GCACTGCCCGTGAGCCCACAGGG + Intergenic
955220478 3:57019244-57019266 GCACTCCCAGAGGGCTCTGTAGG + Intronic
966619945 3:181952871-181952893 GCCCTCTCAGAGAGCTCTCAGGG - Intergenic
968666753 4:1826607-1826629 GCACCCCCAGTGGGTCCTCAGGG - Intronic
968851440 4:3082514-3082536 GCTATCACAGTGAGGTCTCAGGG + Intronic
971869204 4:32214480-32214502 ACACTCCCACTGTGCGCTCACGG - Intergenic
973179690 4:47252165-47252187 GGAGACCCAGTGAGCTCCCAAGG + Intronic
974064591 4:57065902-57065924 TCACTCCCAGAGGACTCTCAGGG + Intronic
979703543 4:123694248-123694270 GCATTCCCACTGAACTCACATGG - Intergenic
989163443 5:38412831-38412853 GCACTCCAGGTGAGCTTTCAGGG + Intronic
991564489 5:67990795-67990817 GCACTCAGAGTCAGCCCTCATGG + Intergenic
992501897 5:77351393-77351415 TCATTCCCAGTGTGCTCTAAAGG + Intronic
997980386 5:138464782-138464804 GCACTCCCGGTTCGCTCTCACGG + Intergenic
998613554 5:143715620-143715642 GGACTCCCTGAAAGCTCTCAGGG + Intergenic
999496750 5:152106720-152106742 GCTCTCCCAGTGAGGCCTCCAGG + Intergenic
1000161430 5:158601287-158601309 GCTCTCCCAATAAGATCTCAGGG - Intergenic
1003829166 6:9987550-9987572 GCACTCTCAGTTAGCACTGAAGG - Intronic
1006436049 6:34026704-34026726 GCCCTCACAGAGAGCTCTGATGG - Intronic
1010011328 6:71051330-71051352 ACACTCGCAGTCAGCCCTCAGGG - Intergenic
1012224990 6:96693903-96693925 GGAGACCCAGTGAGCTCCCAGGG - Intergenic
1013771268 6:113630890-113630912 GAAATCCCTGTGAGCTCTAAAGG + Intergenic
1018296556 6:162352167-162352189 GCACTCCCAGTGAATTCCTATGG + Intronic
1019761358 7:2815193-2815215 GCACTGTGAGTGTGCTCTCAAGG + Intronic
1020112467 7:5455315-5455337 GCACTCTCAAGGAGCACTCAGGG + Intronic
1022578425 7:31522363-31522385 TCACTGCCATTGAGCACTCACGG + Intronic
1024334698 7:48195538-48195560 GCACTCCCACTGAACTGACAGGG + Intronic
1030966310 7:115996611-115996633 GAGCACCCAGTGAGCTCTTAGGG + Intronic
1034438107 7:151073017-151073039 GAACTAACAGTGAGCTCTAATGG - Intronic
1035205637 7:157292315-157292337 ACACGCTCAGTGAGCTCTCCCGG - Intergenic
1035438540 7:158877993-158878015 GCACTCACAGTCAGCCCTCCTGG - Intronic
1035438578 7:158878132-158878154 GCACTCACAGTCAGCCCTCCTGG - Intronic
1039032219 8:33322882-33322904 TAACTCACAGTGAGCTCTGAAGG - Intergenic
1041944702 8:63427898-63427920 TCACTCCCAGTGGCCACTCAGGG - Intergenic
1044107657 8:88231604-88231626 GGCCTCCCAGTGACCTTTCATGG - Intronic
1055327094 9:75142157-75142179 GCACTCCCAGTGAGCTCTCATGG - Intronic
1057629574 9:96708453-96708475 TCACCCCCACTGAGATCTCAGGG - Intergenic
1186200573 X:7151777-7151799 GCATTTCTAGTGAGCTCCCAGGG - Intergenic
1188870543 X:35365604-35365626 GCACCCACACTGAGCTCCCATGG - Intergenic
1189020741 X:37336070-37336092 GAAGTCCCAGTGGGCTCTTAGGG - Intergenic
1190316776 X:49156644-49156666 GCACCCCCAGCCTGCTCTCACGG + Intergenic
1190407307 X:50100919-50100941 GCCCTCCCCTTGAGCTCCCAAGG + Intergenic