ID: 1055327095

View in Genome Browser
Species Human (GRCh38)
Location 9:75142183-75142205
Sequence TGAGGAATTACTTTAAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 348}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055327095_1055327104 13 Left 1055327095 9:75142183-75142205 CCTTTCTTTAAAGTAATTCCTCA 0: 1
1: 0
2: 2
3: 24
4: 348
Right 1055327104 9:75142219-75142241 ATGGGTTCTACTAAGGGAATGGG No data
1055327095_1055327101 6 Left 1055327095 9:75142183-75142205 CCTTTCTTTAAAGTAATTCCTCA 0: 1
1: 0
2: 2
3: 24
4: 348
Right 1055327101 9:75142212-75142234 GATGGAGATGGGTTCTACTAAGG No data
1055327095_1055327102 7 Left 1055327095 9:75142183-75142205 CCTTTCTTTAAAGTAATTCCTCA 0: 1
1: 0
2: 2
3: 24
4: 348
Right 1055327102 9:75142213-75142235 ATGGAGATGGGTTCTACTAAGGG No data
1055327095_1055327098 -6 Left 1055327095 9:75142183-75142205 CCTTTCTTTAAAGTAATTCCTCA 0: 1
1: 0
2: 2
3: 24
4: 348
Right 1055327098 9:75142200-75142222 TCCTCATGGATAGATGGAGATGG No data
1055327095_1055327103 12 Left 1055327095 9:75142183-75142205 CCTTTCTTTAAAGTAATTCCTCA 0: 1
1: 0
2: 2
3: 24
4: 348
Right 1055327103 9:75142218-75142240 GATGGGTTCTACTAAGGGAATGG No data
1055327095_1055327100 -5 Left 1055327095 9:75142183-75142205 CCTTTCTTTAAAGTAATTCCTCA 0: 1
1: 0
2: 2
3: 24
4: 348
Right 1055327100 9:75142201-75142223 CCTCATGGATAGATGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055327095 Original CRISPR TGAGGAATTACTTTAAAGAA AGG (reversed) Intronic
903561223 1:24229468-24229490 TTAAGAATTACTTTAAAATAAGG - Intergenic
903628321 1:24746672-24746694 CGAGTTTTTACTTTAAAGAAAGG + Intronic
904147656 1:28406915-28406937 TGAGGAACATCTTTGAAGAAGGG - Intronic
904679688 1:32220737-32220759 TGAGGATTAAATTTAATGAATGG - Intronic
905980160 1:42218140-42218162 TGAGGATTTAGTTAAAGGAAAGG - Intronic
906265907 1:44429207-44429229 TGAGCAATTGTTTTAAAGAGAGG + Intronic
906550728 1:46664604-46664626 TGAGGAATTAGCTTAAACAGAGG - Intronic
907317984 1:53584679-53584701 TAAGGAAGGACTCTAAAGAAGGG + Intronic
907503092 1:54897845-54897867 TGAGTAAGTACTTAAAAGGAGGG + Intergenic
908632892 1:66129789-66129811 AGAGGAATTTCTTTAAAATATGG + Intronic
908768109 1:67572290-67572312 AGGGGAATTAGTTTAAAGACAGG - Intergenic
909226859 1:73035805-73035827 TGAGTAATTACTTAAAAAATAGG + Intergenic
910091067 1:83464877-83464899 GGAGGCATTACTTTAAAGTGAGG + Intergenic
910910571 1:92229708-92229730 TCAAGAATTACCCTAAAGAAGGG + Intronic
911927973 1:103860933-103860955 TGTGGATTTACTTCACAGAATGG + Intergenic
912065005 1:105726736-105726758 TGAATAATTACTTTGAAGGAAGG - Intergenic
912280959 1:108312928-108312950 TGAATAATTGCTTTAAAAAAAGG - Intergenic
912770943 1:112463877-112463899 TGATGAAGTCCTCTAAAGAAGGG + Intergenic
913149563 1:116027221-116027243 TGAGAGGTTACTTTAAACAAGGG - Intronic
914326734 1:146624777-146624799 TTAGGGAATAGTTTAAAGAATGG - Intergenic
915103428 1:153516567-153516589 TAAGGTTTTATTTTAAAGAAAGG - Intergenic
916498648 1:165367803-165367825 TCAGGAATTTTTTAAAAGAAAGG + Intergenic
916667487 1:166979514-166979536 TAAGAAAATGCTTTAAAGAAAGG + Intronic
916903846 1:169259806-169259828 TGAAGAATAACTTTTAAAAACGG + Intronic
920776841 1:208946894-208946916 TGCAGATTTACTTAAAAGAAAGG - Intergenic
920810892 1:209284533-209284555 TGAGGTAAAACTGTAAAGAAAGG + Intergenic
921963760 1:221065367-221065389 AGAGGAAGTATTTTGAAGAAAGG + Intergenic
922267516 1:223998252-223998274 TGAAGTGTTACTTTAAAGGAAGG - Intergenic
1065633399 10:27705843-27705865 TGAAGACTTTCTTTAAAAAATGG + Intronic
1066214213 10:33270205-33270227 TAGGGAAGTACTTTAAATAAAGG - Intronic
1066726196 10:38397356-38397378 TGAAGTGTTACTTTAAAGGAAGG + Intergenic
1068639495 10:59387361-59387383 TGAGGAGTAACTTTAGTGAAAGG - Intergenic
1068683500 10:59844979-59845001 TCAGTAATTACTTTAAAATACGG - Intronic
1071013413 10:80966299-80966321 TGAAGAATTACTTTAGAATAAGG + Intergenic
1072490707 10:95903632-95903654 TGTGGAATGACTTTAAAAAATGG + Intronic
1073350125 10:102813592-102813614 TGAGATTTGACTTTAAAGAAAGG - Exonic
1073360719 10:102896364-102896386 TGAGAAATCACTTTCAAAAATGG + Intronic
1073615145 10:104987238-104987260 AGAAAAATTATTTTAAAGAATGG + Intronic
1073633284 10:105170659-105170681 CGAGGGATTGCTTTAGAGAATGG - Intronic
1073829865 10:107371187-107371209 TGATGAAATACTTTAAAGCAAGG + Intergenic
1073950431 10:108802527-108802549 TAAGTAATTATTTCAAAGAAAGG - Intergenic
1074195841 10:111184360-111184382 TGAGAAATTATTTTGAAAAAAGG + Intergenic
1074230996 10:111535125-111535147 TGAAGAAAGACTTTAAAAAATGG + Intergenic
1078318763 11:10314229-10314251 TAAGAAATTAATATAAAGAATGG - Intronic
1079028529 11:16967871-16967893 TGGGCAATTAGTCTAAAGAAAGG - Intronic
1080820553 11:35801915-35801937 TCAGGAATTAATTTAAAAACGGG - Intronic
1082680149 11:56157735-56157757 TGAGAAACTATTTTAAAGAGAGG + Intergenic
1082742360 11:56925074-56925096 TAAGGAATAACTTGAAGGAAAGG - Intergenic
1083495969 11:63053311-63053333 TCAGGTATTCCTTTATAGAAAGG + Intergenic
1083862413 11:65428796-65428818 TGAAGAATTATTTAAAAGAGAGG - Intergenic
1085665031 11:78407173-78407195 TGAGAAAGTACTTGAAATAATGG + Intronic
1085745311 11:79110075-79110097 TGAGGGAAGACTTTATAGAAGGG - Intronic
1087451873 11:98333690-98333712 TGAGCAATTAAGTAAAAGAATGG - Intergenic
1087523950 11:99283203-99283225 TTTGTAAATACTTTAAAGAAAGG - Intronic
1089482985 11:118822049-118822071 TGGTGTTTTACTTTAAAGAAGGG - Intergenic
1091119023 11:133041507-133041529 TGAGGAATAACTTCCAGGAAAGG + Intronic
1091366008 11:135021295-135021317 TGATGAATTAATCTAAAGTATGG + Intergenic
1091980140 12:4858108-4858130 TGTGGATGTACTTTAAGGAAAGG - Intergenic
1092588834 12:9930897-9930919 TGAGGAGTTAATTAATAGAATGG - Intronic
1093159066 12:15723386-15723408 AGAGGAATGGTTTTAAAGAAAGG - Intronic
1093349789 12:18084470-18084492 TGATGATTTACTAAAAAGAAAGG + Intronic
1093381978 12:18504122-18504144 TGAGGAATTTCTCAAAATAAGGG - Intronic
1095645792 12:44544524-44544546 TGAGGAACTCCTTGTAAGAAAGG + Intronic
1095645849 12:44545345-44545367 GGAGGAAATCCTTTTAAGAAAGG + Intronic
1096067577 12:48753421-48753443 AAATGAATTTCTTTAAAGAAAGG + Intergenic
1096202972 12:49699023-49699045 TCGGAAATGACTTTAAAGAAGGG - Intronic
1097737238 12:63195529-63195551 GGAGGAATTTCCTTAAAGTAAGG + Intergenic
1098332009 12:69362697-69362719 TGAAAACTTGCTTTAAAGAATGG - Intronic
1099282447 12:80668191-80668213 TGTGGATTTCTTTTAAAGAAAGG - Intronic
1099504778 12:83460340-83460362 TGAGCAATTGATTAAAAGAAAGG - Intergenic
1099745328 12:86695415-86695437 TGAGTATATACTCTAAAGAAGGG + Intronic
1100089260 12:90950803-90950825 TTAGGCATTTCTTTCAAGAATGG - Intronic
1100558661 12:95724048-95724070 TGAGGATTTACTTCTAAAAATGG + Intronic
1104340869 12:127947240-127947262 GGAGGAATTAGTTTTAGGAAGGG - Intergenic
1106063670 13:26322244-26322266 AGAGTAATTTTTTTAAAGAATGG + Intronic
1106345128 13:28869365-28869387 TGTAGAATTACTTTAAATAACGG - Intronic
1106369745 13:29120268-29120290 TGTGGAATTACTTGAAAGAAAGG - Intronic
1106415207 13:29540655-29540677 TGAAGATTTTCTTGAAAGAAGGG - Intronic
1107574168 13:41699022-41699044 TGAGGAATGACTTACATGAAAGG - Intronic
1107877464 13:44803443-44803465 TGGGGATTTACTATAAACAATGG - Intergenic
1108449049 13:50541898-50541920 TGAGGAAGAACTTTTAGGAAAGG + Intronic
1108654633 13:52518456-52518478 TGAGTAATTATTTTTAGGAAAGG + Intergenic
1109167072 13:59048937-59048959 TGATGAATTCCTCAAAAGAAGGG - Intergenic
1109327211 13:60882191-60882213 TGAGGGATTACTTTTCAGAAGGG + Intergenic
1109339582 13:61038774-61038796 TTATGACTTACTTTAGAGAAAGG + Intergenic
1109609750 13:64749245-64749267 TATGGAATTATTTTAAAGACTGG - Intergenic
1111116735 13:83788461-83788483 TTAGGAATTAACTTAGAGAAAGG - Intergenic
1111308428 13:86447642-86447664 TGAGGAAGCAGTCTAAAGAATGG + Intergenic
1111888929 13:94057596-94057618 AGAGGAAATACCTTCAAGAAAGG + Intronic
1111953838 13:94734175-94734197 TAAGGAAATACTATAAATAATGG + Intergenic
1114273592 14:21120811-21120833 TGAGGAATATCTTTCAAAAAGGG + Intergenic
1114860475 14:26512368-26512390 TGAGGGAATAGTTTAAAGCAGGG + Intronic
1115119509 14:29923915-29923937 GGAGGAATTGTTTTAAAGCAAGG - Intronic
1115787338 14:36841362-36841384 TGAGGAAGAACTCTAAAGAACGG - Intronic
1116131313 14:40858166-40858188 TAAGGTATTACTTAAAAAAATGG + Intergenic
1116924075 14:50615376-50615398 TTTAAAATTACTTTAAAGAAAGG + Intronic
1117173550 14:53125679-53125701 TGAGGAATTAAATTAAAAGATGG + Intronic
1117387850 14:55234100-55234122 TGGAGAATTACTTTACAGACTGG + Intergenic
1117477330 14:56109761-56109783 AGATGAATTGCTTTTAAGAAGGG - Intergenic
1117487518 14:56213090-56213112 TTAGGAATAATTTTAAAGATGGG - Intronic
1119054958 14:71409699-71409721 TGAGTAATTTCTATAAACAAGGG - Intronic
1119144407 14:72297831-72297853 TTAGGAATAATTTTAATGAAAGG - Intronic
1119247180 14:73121124-73121146 TGAGTACTTATTTAAAAGAAAGG + Exonic
1119894004 14:78204537-78204559 TGGGGAATTACTTAAATTAATGG + Intergenic
1121945296 14:98114994-98115016 TGAGGAATCATTTTAAACAATGG - Intergenic
1122746761 14:103901810-103901832 TGATGAATTATTTTAAAATAAGG + Intergenic
1123817050 15:23990812-23990834 AGGGGAATTACTATAGAGAAAGG + Intergenic
1124130868 15:26984563-26984585 TGAAGCATTACTTAAAAGGATGG - Intronic
1124255932 15:28142816-28142838 TGAAACATTACCTTAAAGAATGG + Exonic
1124568314 15:30836308-30836330 TGAAACATTACCTTAAAGAATGG - Intergenic
1125048022 15:35265434-35265456 TTAGGCATTTCTTCAAAGAAAGG + Intronic
1128614516 15:69098823-69098845 GCAGGAGTTAATTTAAAGAAAGG + Intergenic
1129203138 15:74017818-74017840 TGAGGAATCAGTGTAAGGAAGGG - Intronic
1129652530 15:77501412-77501434 AGAGGAGTCACTTAAAAGAAGGG - Intergenic
1129915141 15:79262950-79262972 TAAGGAATTAATTTGGAGAAAGG - Intergenic
1130207729 15:81893451-81893473 TGAGAAAATACTATAAAGACTGG + Intergenic
1130210909 15:81920454-81920476 TGAGGAAGGACTTGAAAAAATGG - Intergenic
1130250381 15:82296554-82296576 GGAAGAATTCATTTAAAGAAAGG - Intergenic
1130453990 15:84085967-84085989 GAATGAATGACTTTAAAGAAGGG + Intergenic
1131567006 15:93495227-93495249 AGATGTGTTACTTTAAAGAATGG - Intergenic
1134446429 16:14334779-14334801 TCTGGAATTAATTTAAGGAAAGG - Intergenic
1137683010 16:50367828-50367850 TGAGGAGCTGCTTCAAAGAATGG - Intronic
1138058640 16:53863868-53863890 GGTGGAATTAGATTAAAGAAGGG - Intronic
1140006830 16:71086168-71086190 TTAGGGAATAGTTTAAAGAATGG + Intronic
1140263323 16:73399248-73399270 TGTGGAATTAATTTTTAGAAAGG + Intergenic
1140531515 16:75670842-75670864 TCAGGAATAAATTTACAGAAGGG - Intronic
1144410099 17:14992425-14992447 TAAAGAATTATTTTAAAGAGTGG - Intergenic
1144475052 17:15579711-15579733 TGAGACATTACTTAACAGAAAGG + Intronic
1145831942 17:27923460-27923482 TGACGAACTTCTTGAAAGAATGG - Intergenic
1146252448 17:31360433-31360455 TGGGGATTTACTTAAAAAAAAGG + Intronic
1146937182 17:36819171-36819193 TCAGGAATTTCTTTAGAGGAGGG - Intergenic
1147467794 17:40624717-40624739 TGAGGAGCCACTTGAAAGAAAGG - Intergenic
1148521052 17:48275317-48275339 GGAGGAAATAATTTCAAGAAAGG - Intronic
1148706747 17:49640798-49640820 TGAGGAATCACAACAAAGAACGG - Intronic
1150267423 17:63840573-63840595 TGAGCAAATAGTTGAAAGAAGGG - Intronic
1153574069 18:6503355-6503377 TAAGGAAAAACTATAAAGAAAGG + Intergenic
1154345111 18:13536344-13536366 TTAGGAATAAATTTAATGAAAGG - Intronic
1154368321 18:13732445-13732467 TAAGGAATTACATTAATAAAGGG - Intronic
1156338418 18:36189021-36189043 TGAAGAGTTGCTTCAAAGAATGG - Intronic
1159092715 18:63867947-63867969 TGAGGAATTTTTGTAAAGCAAGG + Intergenic
1159177945 18:64863181-64863203 TTAGGAAATACATTAGAGAAAGG - Intergenic
1159545284 18:69833293-69833315 TGAGAACATACCTTAAAGAAAGG + Intronic
1162118973 19:8450170-8450192 TGAAGAATCACTTTATATAAGGG + Intronic
1162560888 19:11417777-11417799 AGAGGAATCACATGAAAGAATGG - Intronic
1164664700 19:30020021-30020043 TTAGGAATTATTTCAATGAATGG - Intergenic
1164830559 19:31317037-31317059 AGAGGAATTACAACAAAGAAAGG + Intronic
1165001988 19:32771802-32771824 TTCCAAATTACTTTAAAGAAGGG + Intronic
1165019739 19:32914227-32914249 TAAGGAATTAGTTAAATGAAAGG - Intronic
1165024907 19:32953267-32953289 TCAGGCATGAATTTAAAGAAAGG + Intronic
1166513490 19:43427705-43427727 TGAGGTAATTCTTTAAAGCAAGG - Intergenic
1166939068 19:46352010-46352032 TGAGGACTGACATTACAGAAGGG - Intronic
1167008957 19:46793908-46793930 TGAGGAATTAGATGAATGAAGGG + Intergenic
926050400 2:9740783-9740805 TGAGGAGTTATTTTTAAGCAAGG + Intergenic
926374933 2:12217715-12217737 TGAGAATTTACTTTCAACAATGG + Intergenic
927443963 2:23141624-23141646 GGAGGAATTGCTTCATAGAATGG - Intergenic
928187461 2:29125339-29125361 TGAGGAAATACTTGAAGTAAGGG - Intronic
928946054 2:36772970-36772992 TGAGCAATTTCTCTAAAGCAAGG - Intronic
928999090 2:37328012-37328034 TGATGAATAAATTTAAAAAACGG - Intergenic
930213990 2:48673879-48673901 TTATGACTTACTTTAAAGGAAGG + Intronic
930541286 2:52710138-52710160 TGAGGCAGGTCTTTAAAGAAAGG - Intergenic
931653185 2:64487270-64487292 CGAGGAAGTGCTTTAGAGAAAGG + Intergenic
931895880 2:66729053-66729075 TGAGAACTTATTTTAAATAAAGG + Intergenic
932563139 2:72889512-72889534 TGAGGAAGAACTTGAAAGCAAGG - Intronic
933319951 2:80760882-80760904 TGAAGAATGACTTTAATGAGAGG + Intergenic
933338195 2:80986876-80986898 TGAGGAATTAACTCAAAGATTGG + Intergenic
933379483 2:81524575-81524597 TGAGGAACTATATGAAAGAAAGG - Intergenic
933391254 2:81670822-81670844 TGAGAAATAACTTTAAAATATGG + Intergenic
934930528 2:98418833-98418855 AGGGGCAATACTTTAAAGAATGG - Intergenic
935207758 2:100911255-100911277 TGAAGAATTACTTGAAGAAAGGG - Intronic
937820069 2:126300535-126300557 TGAGTAATTCATTTTAAGAAGGG + Intergenic
937835140 2:126463865-126463887 TGGGAGGTTACTTTAAAGAAAGG - Intergenic
937896409 2:126979662-126979684 TGGGGCATTACTTTAACAAAAGG - Intergenic
939538663 2:143464974-143464996 TGAGGAACTATTTTAAAAGAAGG - Intronic
941555249 2:166971354-166971376 TCAGGAGATACTTTGAAGAAAGG + Intronic
943089719 2:183359447-183359469 GGATGACTTACTTTTAAGAATGG + Intergenic
943267542 2:185754090-185754112 TTAGTAATTACTTTAAATATAGG - Intronic
943440717 2:187924372-187924394 TGACTATTTACTTTTAAGAAGGG - Intergenic
944032886 2:195258981-195259003 TGATGAATGACTTAAGAGAATGG - Intergenic
945441291 2:209883361-209883383 GGGGGAATTACTTAATAGAAAGG - Intronic
946581722 2:221135560-221135582 TGATGAATTACTTGAAAGCAGGG + Intergenic
947887684 2:233587530-233587552 TGGGCAATTCCTTTTAAGAAGGG - Intergenic
947893903 2:233650557-233650579 TGAGTAATTCCTTTTAAGAAGGG - Intronic
1168998798 20:2151610-2151632 TGAGGTGTTTCTTTAAATAAGGG - Intronic
1169609249 20:7360867-7360889 TGAGGAAATTCTTTAAAAAGTGG - Intergenic
1170248817 20:14256284-14256306 TGAGGAATTTCTTTAAAAGTTGG - Intronic
1171949794 20:31410983-31411005 TGATGGAGTTCTTTAAAGAAGGG - Intronic
1174213228 20:48896405-48896427 TGATAAATAACTTTAAAAAAGGG + Intergenic
1174403238 20:50287510-50287532 TGAAGAATGACCTTAGAGAATGG - Intergenic
1177547048 21:22572289-22572311 TGGGGAAAAACTTTGAAGAAAGG + Intergenic
1178079631 21:29050332-29050354 TGATGAATCATTTTGAAGAATGG + Intronic
1179263371 21:39778542-39778564 TGAGGAATTAATTTGAGGATCGG + Intronic
1179900023 21:44386518-44386540 TGAGGAATTAATTAAACCAAGGG + Intronic
1181993424 22:26855856-26855878 TGCCAAATTACCTTAAAGAAGGG + Intergenic
1184123726 22:42471833-42471855 AGAGGAATTACTTAAAGGAAGGG - Intergenic
1184547305 22:45180015-45180037 TGAGGATATACTTGAAAGCAGGG - Intronic
1184953971 22:47869334-47869356 TGTGGTTTTGCTTTAAAGAAAGG + Intergenic
949863047 3:8523884-8523906 AGAGGATTTACTTTCAGGAAGGG + Intronic
950769761 3:15302069-15302091 TGAGGATTTAATTTAAACATTGG - Intronic
951660539 3:25059285-25059307 TGAGGAAATAATTAAAAGCAAGG - Intergenic
952035626 3:29196914-29196936 TGAAGAATTATATAAAAGAAGGG - Intergenic
952322129 3:32287745-32287767 TGAGGGAATACATTAAATAATGG - Intronic
952521584 3:34164196-34164218 TGATGAATTATTCTACAGAATGG - Intergenic
952926298 3:38322396-38322418 TGAGTAATTACCTTGAAGGAAGG - Intergenic
953361983 3:42305314-42305336 AGAGGAATAACTTGAAAGGAGGG + Intergenic
954174269 3:48831255-48831277 TGAGGGATTACATTATAAAATGG - Intronic
955701962 3:61690491-61690513 GGAGGAATTACTGCAAAGAGTGG + Intronic
956159606 3:66335377-66335399 TGACGAATAAATGTAAAGAATGG + Intronic
957089660 3:75717088-75717110 TGGGGATTTTCTCTAAAGAATGG + Intronic
957222411 3:77401133-77401155 TGAGGAAGTAATCTAAACAAAGG - Intronic
957472698 3:80679559-80679581 TGAAGAATTAATTTACAAAAAGG + Intergenic
957514509 3:81233224-81233246 TCAGGAATGATTTTAAAGCATGG - Intergenic
959911717 3:111771039-111771061 TGAGAACTAACATTAAAGAAAGG - Intronic
959959546 3:112281899-112281921 TGAATAATTAGTTTTAAGAAGGG + Intronic
961112344 3:124295759-124295781 TGAGAAATTATTTTAAAATAGGG + Intronic
961155705 3:124677850-124677872 TGAGGAATTCCTCTTGAGAAGGG - Intronic
961189513 3:124946247-124946269 AGAGGAGTTGCTGTAAAGAAAGG - Intronic
961376236 3:126467923-126467945 TTAGCAAGTACTTTAAAAAATGG - Intronic
962589014 3:136869992-136870014 TGTGGAAATATTTAAAAGAATGG + Intronic
964778751 3:160311568-160311590 GGAGGAATGACTGTAAAGAGGGG + Intronic
964909995 3:161769223-161769245 TTAAAAATTACTTTAAAAAAGGG + Intergenic
965455798 3:168898469-168898491 TGAGGAATTACTAAAAAAAAAGG + Intergenic
966254625 3:177903766-177903788 TCAGGAATTATTGAAAAGAATGG + Intergenic
966538645 3:181064052-181064074 CTAGGAAATACTTCAAAGAAAGG - Intergenic
967473677 3:189891390-189891412 TAAGGTACTAATTTAAAGAAAGG - Intronic
967528992 3:190527801-190527823 TGATAAATTATTTTAAGGAAAGG + Intronic
970740234 4:19228995-19229017 TTATGAATTACTTTAACCAAGGG - Intergenic
970967093 4:21941028-21941050 TGAGAAACTACTTTAAAAAATGG - Intronic
971038529 4:22723266-22723288 TGAAGAATTTCTTCACAGAAGGG - Intergenic
971366658 4:25983145-25983167 TGAGTAATTTCTTGAAAAAAAGG + Intergenic
971636040 4:29059220-29059242 TTAGGCTTTACTTCAAAGAAAGG - Intergenic
971737017 4:30466890-30466912 TAAGCACATACTTTAAAGAATGG - Intergenic
971741198 4:30524146-30524168 TGGGTATTTACCTTAAAGAAAGG - Intergenic
971951928 4:33362037-33362059 TGATAAATTATTTTAAACAACGG - Intergenic
972040076 4:34582667-34582689 TGAGGAATTACTTTCTGGTATGG + Intergenic
972650793 4:41015744-41015766 TAAATAATAACTTTAAAGAATGG - Intronic
973548442 4:52006130-52006152 TGAGGAATCGCTTTAAAGCTAGG - Intronic
974404780 4:61452047-61452069 TGGGGAATTACTCTGAAAAAGGG - Intronic
975408805 4:74023748-74023770 CTGGGAATTACTATAAAGAAAGG + Intergenic
976235510 4:82891864-82891886 GGAGGAATTATTTTACAGCAAGG + Intronic
976317886 4:83678761-83678783 TGAGGCATGAATTTAAAGAATGG + Intergenic
977384387 4:96320592-96320614 CAAGGAATAAGTTTAAAGAAAGG - Intergenic
977934700 4:102788069-102788091 TGAGGAACTACTTTATTGAAAGG + Intergenic
978270367 4:106882278-106882300 TTATGACTTACTTTAGAGAAAGG + Intergenic
979428099 4:120592989-120593011 TGATAAAGTACTTTATAGAAGGG - Intergenic
979542533 4:121901841-121901863 TGAGGTATTATTTTAAATCATGG + Intronic
979832107 4:125316001-125316023 TGAGGAATCATTGCAAAGAACGG - Intergenic
981561094 4:146049390-146049412 TAAGGTAATATTTTAAAGAAAGG + Intergenic
982427876 4:155287073-155287095 TGAGGAGTGACTTTAAAGTTTGG - Intergenic
982440855 4:155433971-155433993 TGAGGAAAAACATTAAAGGATGG + Intergenic
983817094 4:172144707-172144729 TGATGAATTGCTTTTAAGATGGG - Intronic
983906492 4:173188375-173188397 TCAGGCATTACTTTAAACAGGGG + Intronic
987463140 5:18238475-18238497 TGAGGCATTCCTTTCAAGAAAGG - Intergenic
987596461 5:20006387-20006409 ATAGGAATTACTTTAGGGAATGG + Intronic
987885710 5:23808855-23808877 AGAGAAATTACTTTAAAAAAAGG - Intergenic
988004831 5:25395931-25395953 TGAATAATTAGTTTTAAGAAAGG + Intergenic
988427329 5:31078875-31078897 TGGGGGATTATTTTAAAGATAGG - Intergenic
990509652 5:56479105-56479127 TGAGAAATTACTCTAAATCAGGG - Intronic
990662477 5:58032385-58032407 TTAGGAATCAATTTAATGAAAGG - Intergenic
991198855 5:63966482-63966504 TTACCAAATACTTTAAAGAATGG - Intergenic
991368210 5:65891138-65891160 TGAGGAATTTTATTAAGGAATGG + Intergenic
991657601 5:68919739-68919761 TGAGAAATTGCTGTAAAGAATGG - Intergenic
993113047 5:83683474-83683496 TGAGCAATTACATAAAAGACTGG + Intronic
993238968 5:85354709-85354731 TGAAGAATTAATTTTAAAAAGGG + Intergenic
993427096 5:87779834-87779856 TGAGCAAATATTTTAAAGTAAGG - Intergenic
993793009 5:92230522-92230544 TGAGGAAATTCCTCAAAGAAAGG + Intergenic
994417566 5:99493378-99493400 TGAGTAACTAATTTAAAAAAAGG + Intergenic
994462397 5:100081790-100081812 TGAGTAACTAATTTAAAAAAAGG - Intergenic
994596925 5:101850631-101850653 TGAAAAATTTCTTGAAAGAAAGG - Intergenic
995195423 5:109361539-109361561 TGAGGAATTACTTTGCATAATGG + Intronic
995790960 5:115885807-115885829 GGATGAAATACTTTAAAGAATGG + Intronic
996091907 5:119359532-119359554 CAAGGATTAACTTTAAAGAATGG - Intronic
996191422 5:120547337-120547359 TGAGAAAGTACTTTAAAAATGGG + Intronic
996518380 5:124399038-124399060 TAAGGAAAATCTTTAAAGAAAGG - Intergenic
996737549 5:126771937-126771959 TCAGGAATTACTTGAATAAAGGG + Intergenic
996763812 5:127015130-127015152 TGAGAAATTACTTTCAAATACGG + Intronic
997443513 5:133925442-133925464 TGAGGAAGTACTTGAAGGAGGGG - Intergenic
998250892 5:140551566-140551588 TGAAGAATGTCTTAAAAGAAAGG - Intronic
999422363 5:151456058-151456080 TGAGGAATCCCTTTAAATTACGG - Intronic
1002544800 5:179933244-179933266 TGAGGAAATATTTTAAACTATGG + Intronic
1003669835 6:8146834-8146856 TTATGAATTACTTTAGAAAAGGG + Intergenic
1004715828 6:18215553-18215575 TGGGTAATTACTTTAAAGTGAGG - Intronic
1004740389 6:18454703-18454725 TGATGAATTACTATAAAGAAAGG - Intronic
1005027524 6:21477698-21477720 TGATAAATTATATTAAAGAATGG - Intergenic
1005037595 6:21570835-21570857 TTATGACTTATTTTAAAGAAAGG + Intergenic
1005153919 6:22781982-22782004 GGAAGATTTACTTTAAAAAATGG + Intergenic
1008264502 6:49408148-49408170 TGAGGAATAAATTTAATGTAAGG + Intergenic
1009676851 6:66836537-66836559 TCAGCAGTTATTTTAAAGAATGG + Intergenic
1010330397 6:74616871-74616893 TGAGGAATCACTTTCCAGAATGG + Intergenic
1011143072 6:84181497-84181519 CAAGTAATTACTTTAAATAATGG + Intronic
1011657062 6:89561641-89561663 TGATGAGTTTCTTTAAAGTACGG + Intronic
1012194782 6:96327845-96327867 TGAGGAATCACTTTCCACAATGG - Intergenic
1012306498 6:97664835-97664857 TAATAAATTACTTTAAAAAATGG - Intergenic
1012828716 6:104180078-104180100 AGAGGAGTTATTTTAAGGAAAGG - Intergenic
1013041649 6:106440194-106440216 TGAGGATGTGCTTTAAAGGAAGG - Intergenic
1013319445 6:108972629-108972651 TAAGGAATTAGTTGAAATAAGGG + Intronic
1013348668 6:109286858-109286880 TGAAGAAATACTTTATGGAAAGG + Intergenic
1013725765 6:113093659-113093681 TGAGAAATTATTTTAAGGCAAGG + Intergenic
1014019159 6:116567807-116567829 TGAGGAAAGACTTGAAGGAAGGG + Intergenic
1015222874 6:130825086-130825108 TTAGGTAGGACTTTAAAGAAGGG - Intergenic
1015328022 6:131946943-131946965 TTAGGAATTAATTGACAGAAAGG + Intergenic
1015995379 6:138990986-138991008 TGAGGACTTACTGTATTGAATGG - Intergenic
1017574630 6:155788523-155788545 TCAGGAAGAACTATAAAGAAAGG + Intergenic
1019914946 7:4126956-4126978 TGAGGATTTACACAAAAGAAGGG - Intronic
1020989115 7:15173779-15173801 TGAAAATTTAGTTTAAAGAAAGG + Intergenic
1021615279 7:22497729-22497751 TGGGTAATTATTATAAAGAAAGG + Intronic
1023109029 7:36791637-36791659 TGAGGAGTTGCTTTAGAGAAAGG + Intergenic
1023161182 7:37297569-37297591 TAAAGACTTACTTTGAAGAATGG + Intronic
1024068303 7:45763419-45763441 TGAAGTGTTACTTTAAAGGAAGG + Intergenic
1024418661 7:49137293-49137315 TTTGGAATTACTTTCAGGAAGGG - Intergenic
1024474443 7:49795485-49795507 AAAGCAATGACTTTAAAGAAGGG - Intronic
1024732040 7:52263696-52263718 TTAGGAATTACTTCCAACAAAGG - Intergenic
1025956156 7:66184701-66184723 TGAAGCCTGACTTTAAAGAAAGG + Intergenic
1027307910 7:76921369-76921391 GGAGGCATTACTTTAAAGTGAGG + Intergenic
1027856630 7:83520213-83520235 TTAGGCATAACTTGAAAGAAGGG - Intronic
1027925744 7:84461033-84461055 TGATAAATAATTTTAAAGAAAGG - Intronic
1028014393 7:85688130-85688152 TGAGTAATTTATTTAAAAAAAGG - Intergenic
1028127340 7:87128868-87128890 TGAGAAATTAGATAAAAGAAAGG - Intergenic
1028169357 7:87577404-87577426 TGGGGAAATACTCAAAAGAAAGG - Intronic
1028377214 7:90156903-90156925 TGGGTAATTATTATAAAGAAAGG - Intronic
1028804678 7:95011080-95011102 TGAAAAATATCTTTAAAGAAAGG - Intronic
1029187174 7:98747557-98747579 TGAGGAGTTACTGTGAAAAAGGG + Intergenic
1029311450 7:99670061-99670083 TCAGGAATTCCTTAAAAGTATGG + Intronic
1029411678 7:100416464-100416486 TGAGGTTTTATTTTAATGAAAGG + Intronic
1029852421 7:103477054-103477076 TGAGTAAGTAATTGAAAGAAGGG + Intronic
1030238115 7:107289711-107289733 TTAGGAATAACTTTAACAAAAGG - Intronic
1030855422 7:114549810-114549832 TAATGTATTTCTTTAAAGAAAGG - Intronic
1031326403 7:120404474-120404496 TGAGGAAATACTGTAAAGCAAGG + Intronic
1032187431 7:129739007-129739029 TGCAGGATTATTTTAAAGAATGG + Intronic
1033775870 7:144610392-144610414 TGAGGAAATATTTTAAAGGTGGG + Intronic
1035114195 7:156508986-156509008 TGAGAAATTACTTAAAAGCCAGG + Intergenic
1037110802 8:15162283-15162305 CGAGGAATTTTTTTAAAAAACGG + Intronic
1038087795 8:24219001-24219023 TAAGGACTTACTTGGAAGAAAGG + Intergenic
1038527265 8:28286649-28286671 TGAGAAATTCATTTAAAAAATGG - Intergenic
1038935411 8:32244510-32244532 TGAGGAATGTCTCAAAAGAAAGG + Intronic
1039214905 8:35259140-35259162 TTAGGAATTACATTATCGAAAGG - Intronic
1039603530 8:38862347-38862369 GCAGGAATTTCTCTAAAGAAGGG - Intergenic
1040831965 8:51687254-51687276 TGACAAATTTCTTTAGAGAAGGG - Intronic
1041627757 8:60050139-60050161 TGTGAAAGTACTTTAATGAATGG + Intergenic
1042678296 8:71348281-71348303 TCAGGAATTACTTAAAAGCAGGG + Intronic
1042899536 8:73709192-73709214 TGAAGAATGACTTTACAAAATGG + Intronic
1043781854 8:84346306-84346328 TAATAAATTACTTTAAAGACAGG - Intronic
1044052065 8:87517192-87517214 TAATGAATTTTTTTAAAGAAGGG - Intronic
1045069936 8:98492527-98492549 AAAGGAAATAGTTTAAAGAAAGG + Intronic
1045608801 8:103810825-103810847 AGAGGAATTATATGAAAGAAAGG + Intronic
1045985185 8:108241589-108241611 TGTGGAACTACTTTAAAATATGG - Intronic
1046350041 8:112997344-112997366 TGAGTAATTACTTTAAAATGTGG - Intronic
1046538913 8:115554131-115554153 TGAGGAACTAGTTTAGTGAATGG - Intronic
1048004440 8:130407769-130407791 TGAGGAATGGCAATAAAGAAGGG - Intronic
1048131780 8:131705656-131705678 AGAGAAATTACTTTCAACAATGG + Intergenic
1048732795 8:137462540-137462562 TAAGGAAATATTTAAAAGAAAGG + Intergenic
1048754864 8:137727443-137727465 TGAGGTCTTTCTTCAAAGAAAGG + Intergenic
1051164171 9:14244109-14244131 TGAGCAAATATTTTCAAGAATGG + Intronic
1052638185 9:31129485-31129507 AAAGGAAGTGCTTTAAAGAAGGG + Intergenic
1052735190 9:32334470-32334492 TGATGCATTACTTTAAGGGAAGG - Intergenic
1055083993 9:72295568-72295590 TGAGGAAGAAAATTAAAGAAAGG + Intergenic
1055327095 9:75142183-75142205 TGAGGAATTACTTTAAAGAAAGG - Intronic
1055934685 9:81593537-81593559 TGAGGGAATGCTTTACAGAATGG - Intronic
1056275105 9:84986714-84986736 TGATGAATTACTGGAGAGAATGG + Intronic
1059073347 9:111163766-111163788 TGAGGAAGTACAACAAAGAACGG - Intergenic
1059315225 9:113419233-113419255 TGAGGAATAATTTCAAATAAAGG - Intronic
1061672305 9:132195634-132195656 TGGGGAATTTCTTTAGAGACAGG + Intronic
1188334920 X:28919494-28919516 AGAGGAATTTTTTTAAAGCATGG + Intronic
1190497396 X:51039949-51039971 TGAATAATTTCTTTAAAAAATGG + Intergenic
1191008111 X:55732480-55732502 TAAGGAAATCCTTTAATGAAAGG + Intronic
1193020905 X:76791770-76791792 TGGGTATTTATTTTAAAGAAAGG + Intergenic
1194836267 X:98686919-98686941 TAAGAAATTACTTTTAAAAAAGG - Intergenic
1194865216 X:99056443-99056465 TGTAGACTTACTTTAAAAAATGG - Intergenic
1194966184 X:100291257-100291279 TGAAGAATTAATTTAAAAAAAGG - Intergenic
1197390006 X:125851037-125851059 TCAGAAGTTACTTTAAAGAATGG - Intergenic
1198566655 X:137912165-137912187 AGAGGAATAATATTAAAGAAAGG + Intergenic
1198610943 X:138399817-138399839 AGAAGAATTAAGTTAAAGAAGGG + Intergenic
1198729550 X:139714404-139714426 TGAGTAACTAGTTTTAAGAAGGG - Intergenic
1199006244 X:142700256-142700278 TTAGGAATAAATTTAAACAAAGG - Intergenic
1199018015 X:142842143-142842165 TGAGGTGTTGCTATAAAGAATGG + Intergenic
1199840759 X:151645454-151645476 TGCTGAATTACTTTAATGCAAGG - Intronic