ID: 1055327100

View in Genome Browser
Species Human (GRCh38)
Location 9:75142201-75142223
Sequence CCTCATGGATAGATGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055327095_1055327100 -5 Left 1055327095 9:75142183-75142205 CCTTTCTTTAAAGTAATTCCTCA 0: 1
1: 0
2: 2
3: 24
4: 348
Right 1055327100 9:75142201-75142223 CCTCATGGATAGATGGAGATGGG No data
1055327094_1055327100 21 Left 1055327094 9:75142157-75142179 CCATGAGAGCTCACTGGGAGTGC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1055327100 9:75142201-75142223 CCTCATGGATAGATGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055327100 Original CRISPR CCTCATGGATAGATGGAGAT GGG Intronic
No off target data available for this crispr