ID: 1055329375

View in Genome Browser
Species Human (GRCh38)
Location 9:75167598-75167620
Sequence CTGTAGACTCAGTGTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055329375_1055329379 2 Left 1055329375 9:75167598-75167620 CCATCCTCACACTGAGTCTACAG No data
Right 1055329379 9:75167623-75167645 CAACTCAAGGTGAAAGTGTAGGG No data
1055329375_1055329380 12 Left 1055329375 9:75167598-75167620 CCATCCTCACACTGAGTCTACAG No data
Right 1055329380 9:75167633-75167655 TGAAAGTGTAGGGTCATCTTAGG No data
1055329375_1055329378 1 Left 1055329375 9:75167598-75167620 CCATCCTCACACTGAGTCTACAG No data
Right 1055329378 9:75167622-75167644 TCAACTCAAGGTGAAAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055329375 Original CRISPR CTGTAGACTCAGTGTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr