ID: 1055329378

View in Genome Browser
Species Human (GRCh38)
Location 9:75167622-75167644
Sequence TCAACTCAAGGTGAAAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055329372_1055329378 20 Left 1055329372 9:75167579-75167601 CCCTTCCTTCAACAGTTAGCCAT No data
Right 1055329378 9:75167622-75167644 TCAACTCAAGGTGAAAGTGTAGG No data
1055329376_1055329378 -3 Left 1055329376 9:75167602-75167624 CCTCACACTGAGTCTACAGATCA No data
Right 1055329378 9:75167622-75167644 TCAACTCAAGGTGAAAGTGTAGG No data
1055329373_1055329378 19 Left 1055329373 9:75167580-75167602 CCTTCCTTCAACAGTTAGCCATC No data
Right 1055329378 9:75167622-75167644 TCAACTCAAGGTGAAAGTGTAGG No data
1055329375_1055329378 1 Left 1055329375 9:75167598-75167620 CCATCCTCACACTGAGTCTACAG No data
Right 1055329378 9:75167622-75167644 TCAACTCAAGGTGAAAGTGTAGG No data
1055329374_1055329378 15 Left 1055329374 9:75167584-75167606 CCTTCAACAGTTAGCCATCCTCA No data
Right 1055329378 9:75167622-75167644 TCAACTCAAGGTGAAAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055329378 Original CRISPR TCAACTCAAGGTGAAAGTGT AGG Intergenic
No off target data available for this crispr