ID: 1055335310

View in Genome Browser
Species Human (GRCh38)
Location 9:75227581-75227603
Sequence CAGGCCCACCTCCAGTATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055335303_1055335310 -8 Left 1055335303 9:75227566-75227588 CCAATTACCTCCCACCAGGCCCA No data
Right 1055335310 9:75227581-75227603 CAGGCCCACCTCCAGTATTGGGG No data
1055335298_1055335310 2 Left 1055335298 9:75227556-75227578 CCCCCATGATCCAATTACCTCCC 0: 167
1: 5234
2: 10356
3: 11816
4: 10048
Right 1055335310 9:75227581-75227603 CAGGCCCACCTCCAGTATTGGGG No data
1055335299_1055335310 1 Left 1055335299 9:75227557-75227579 CCCCATGATCCAATTACCTCCCA 0: 173
1: 5353
2: 10896
3: 12755
4: 11741
Right 1055335310 9:75227581-75227603 CAGGCCCACCTCCAGTATTGGGG No data
1055335297_1055335310 15 Left 1055335297 9:75227543-75227565 CCATGAGAAACTGCCCCCATGAT No data
Right 1055335310 9:75227581-75227603 CAGGCCCACCTCCAGTATTGGGG No data
1055335300_1055335310 0 Left 1055335300 9:75227558-75227580 CCCATGATCCAATTACCTCCCAC 0: 174
1: 5218
2: 10596
3: 11887
4: 9849
Right 1055335310 9:75227581-75227603 CAGGCCCACCTCCAGTATTGGGG No data
1055335301_1055335310 -1 Left 1055335301 9:75227559-75227581 CCATGATCCAATTACCTCCCACC 0: 150
1: 3993
2: 9305
3: 11638
4: 10387
Right 1055335310 9:75227581-75227603 CAGGCCCACCTCCAGTATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055335310 Original CRISPR CAGGCCCACCTCCAGTATTG GGG Intergenic
No off target data available for this crispr