ID: 1055338611

View in Genome Browser
Species Human (GRCh38)
Location 9:75258923-75258945
Sequence CTCCAACAGACCTGCAGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055338611_1055338618 29 Left 1055338611 9:75258923-75258945 CCTTCGCTGCAGGTCTGTTGGAG No data
Right 1055338618 9:75258975-75258997 TGCCTGGGTATCAGCAGCAGAGG 0: 502
1: 1608
2: 2044
3: 1588
4: 1138
1055338611_1055338616 14 Left 1055338611 9:75258923-75258945 CCTTCGCTGCAGGTCTGTTGGAG No data
Right 1055338616 9:75258960-75258982 GCTCCAGACGCTGTTTGCCTGGG No data
1055338611_1055338615 13 Left 1055338611 9:75258923-75258945 CCTTCGCTGCAGGTCTGTTGGAG No data
Right 1055338615 9:75258959-75258981 CGCTCCAGACGCTGTTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055338611 Original CRISPR CTCCAACAGACCTGCAGCGA AGG (reversed) Intergenic
No off target data available for this crispr