ID: 1055338615

View in Genome Browser
Species Human (GRCh38)
Location 9:75258959-75258981
Sequence CGCTCCAGACGCTGTTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055338611_1055338615 13 Left 1055338611 9:75258923-75258945 CCTTCGCTGCAGGTCTGTTGGAG No data
Right 1055338615 9:75258959-75258981 CGCTCCAGACGCTGTTTGCCTGG No data
1055338610_1055338615 14 Left 1055338610 9:75258922-75258944 CCCTTCGCTGCAGGTCTGTTGGA No data
Right 1055338615 9:75258959-75258981 CGCTCCAGACGCTGTTTGCCTGG No data
1055338608_1055338615 15 Left 1055338608 9:75258921-75258943 CCCCTTCGCTGCAGGTCTGTTGG No data
Right 1055338615 9:75258959-75258981 CGCTCCAGACGCTGTTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055338615 Original CRISPR CGCTCCAGACGCTGTTTGCC TGG Intergenic
No off target data available for this crispr