ID: 1055338618

View in Genome Browser
Species Human (GRCh38)
Location 9:75258975-75258997
Sequence TGCCTGGGTATCAGCAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6880
Summary {0: 502, 1: 1608, 2: 2044, 3: 1588, 4: 1138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055338614_1055338618 -6 Left 1055338614 9:75258958-75258980 CCGCTCCAGACGCTGTTTGCCTG 0: 112
1: 3307
2: 2356
3: 1039
4: 639
Right 1055338618 9:75258975-75258997 TGCCTGGGTATCAGCAGCAGAGG 0: 502
1: 1608
2: 2044
3: 1588
4: 1138
1055338610_1055338618 30 Left 1055338610 9:75258922-75258944 CCCTTCGCTGCAGGTCTGTTGGA No data
Right 1055338618 9:75258975-75258997 TGCCTGGGTATCAGCAGCAGAGG 0: 502
1: 1608
2: 2044
3: 1588
4: 1138
1055338611_1055338618 29 Left 1055338611 9:75258923-75258945 CCTTCGCTGCAGGTCTGTTGGAG No data
Right 1055338618 9:75258975-75258997 TGCCTGGGTATCAGCAGCAGAGG 0: 502
1: 1608
2: 2044
3: 1588
4: 1138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055338618 Original CRISPR TGCCTGGGTATCAGCAGCAG AGG Intergenic
Too many off-targets to display for this crispr