ID: 1055338675

View in Genome Browser
Species Human (GRCh38)
Location 9:75259331-75259353
Sequence GCAGCCAGGAAGATTAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055338675_1055338681 11 Left 1055338675 9:75259331-75259353 CCCAGTTTAATCTTCCTGGCTGC No data
Right 1055338681 9:75259365-75259387 ACTCAAGCCTCAGCAATGGTGGG 0: 190
1: 627
2: 645
3: 462
4: 1157
1055338675_1055338678 7 Left 1055338675 9:75259331-75259353 CCCAGTTTAATCTTCCTGGCTGC No data
Right 1055338678 9:75259361-75259383 ACCTACTCAAGCCTCAGCAATGG 0: 1335
1: 1630
2: 1504
3: 1312
4: 2555
1055338675_1055338680 10 Left 1055338675 9:75259331-75259353 CCCAGTTTAATCTTCCTGGCTGC No data
Right 1055338680 9:75259364-75259386 TACTCAAGCCTCAGCAATGGTGG 0: 1046
1: 1343
2: 949
3: 788
4: 2278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055338675 Original CRISPR GCAGCCAGGAAGATTAAACT GGG (reversed) Intergenic
No off target data available for this crispr