ID: 1055342489

View in Genome Browser
Species Human (GRCh38)
Location 9:75299176-75299198
Sequence GTGTCCACACAGATGAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055342489_1055342490 -9 Left 1055342489 9:75299176-75299198 CCATGCTTCATCTGTGTGGACAC No data
Right 1055342490 9:75299190-75299212 TGTGGACACTCATTCCTGTCTGG No data
1055342489_1055342492 9 Left 1055342489 9:75299176-75299198 CCATGCTTCATCTGTGTGGACAC No data
Right 1055342492 9:75299208-75299230 TCTGGAAACCTATTCCTGTCTGG No data
1055342489_1055342495 25 Left 1055342489 9:75299176-75299198 CCATGCTTCATCTGTGTGGACAC No data
Right 1055342495 9:75299224-75299246 TGTCTGGAAACCTCAGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055342489 Original CRISPR GTGTCCACACAGATGAAGCA TGG (reversed) Intergenic
No off target data available for this crispr