ID: 1055344380

View in Genome Browser
Species Human (GRCh38)
Location 9:75319294-75319316
Sequence TATTACCTATATAAGATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055344380_1055344383 -6 Left 1055344380 9:75319294-75319316 CCACCCATCTTATATAGGTAATA No data
Right 1055344383 9:75319311-75319333 GTAATACTTTTATTAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055344380 Original CRISPR TATTACCTATATAAGATGGG TGG (reversed) Intergenic
No off target data available for this crispr