ID: 1055347328

View in Genome Browser
Species Human (GRCh38)
Location 9:75352650-75352672
Sequence AGCCCCAAAAATAACATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055347328_1055347331 0 Left 1055347328 9:75352650-75352672 CCTTTCATGTTATTTTTGGGGCT No data
Right 1055347331 9:75352673-75352695 GGGTATAAGTAAACAAGAAGAGG No data
1055347328_1055347335 24 Left 1055347328 9:75352650-75352672 CCTTTCATGTTATTTTTGGGGCT No data
Right 1055347335 9:75352697-75352719 CTTTGGAGATGAAGAGTAAAGGG No data
1055347328_1055347333 7 Left 1055347328 9:75352650-75352672 CCTTTCATGTTATTTTTGGGGCT No data
Right 1055347333 9:75352680-75352702 AGTAAACAAGAAGAGGGCTTTGG No data
1055347328_1055347334 23 Left 1055347328 9:75352650-75352672 CCTTTCATGTTATTTTTGGGGCT No data
Right 1055347334 9:75352696-75352718 GCTTTGGAGATGAAGAGTAAAGG 0: 18
1: 37
2: 16
3: 48
4: 334
1055347328_1055347332 1 Left 1055347328 9:75352650-75352672 CCTTTCATGTTATTTTTGGGGCT No data
Right 1055347332 9:75352674-75352696 GGTATAAGTAAACAAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055347328 Original CRISPR AGCCCCAAAAATAACATGAA AGG (reversed) Intergenic
No off target data available for this crispr