ID: 1055347331

View in Genome Browser
Species Human (GRCh38)
Location 9:75352673-75352695
Sequence GGGTATAAGTAAACAAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055347328_1055347331 0 Left 1055347328 9:75352650-75352672 CCTTTCATGTTATTTTTGGGGCT No data
Right 1055347331 9:75352673-75352695 GGGTATAAGTAAACAAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055347331 Original CRISPR GGGTATAAGTAAACAAGAAG AGG Intergenic
No off target data available for this crispr