ID: 1055347334

View in Genome Browser
Species Human (GRCh38)
Location 9:75352696-75352718
Sequence GCTTTGGAGATGAAGAGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 18, 1: 37, 2: 16, 3: 48, 4: 334}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055347328_1055347334 23 Left 1055347328 9:75352650-75352672 CCTTTCATGTTATTTTTGGGGCT No data
Right 1055347334 9:75352696-75352718 GCTTTGGAGATGAAGAGTAAAGG 0: 18
1: 37
2: 16
3: 48
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055347334 Original CRISPR GCTTTGGAGATGAAGAGTAA AGG Intergenic
900579978 1:3404129-3404151 GCTTTGCTCATGAAGATTAACGG + Intronic
900721939 1:4182296-4182318 GCTTTGGAGATGAAGAGTAAAGG + Intergenic
900841388 1:5051287-5051309 ACTTCAGAGATGAAGAGTAAAGG - Intergenic
901237571 1:7675730-7675752 GCAGTGGAGATGGAGAGCAATGG + Intronic
901807585 1:11748160-11748182 GCCTTGGAGATGACGGGAAATGG + Intronic
902304921 1:15529087-15529109 GCTCTGGAAAGGAAGAGAAATGG + Exonic
902534580 1:17112188-17112210 GCTGTGGAAATGGAGAGAAATGG + Intronic
902829991 1:19006194-19006216 GCTATGGAAATGCAGAGGAAGGG - Intergenic
902903155 1:19534131-19534153 GCCTTGGAGATGGAGAGGATGGG + Intergenic
903762619 1:25709487-25709509 GCTTTGGAGCTGGAGAGTTAGGG - Intronic
904029553 1:27525740-27525762 GCTTTGGAGCCCAAGAGGAAAGG - Intergenic
905800617 1:40839985-40840007 GCTTTGCAGAAGAGGAGCAAAGG - Exonic
905842340 1:41192846-41192868 GCTTTGGATATGAAAAGAAGAGG - Intronic
905972123 1:42150179-42150201 GCAGTGGAGATGATGAGAAACGG + Intergenic
906710052 1:47922726-47922748 GCTGTGGAGATGAACAGAAGAGG - Intronic
907321835 1:53607555-53607577 CATTTCCAGATGAAGAGTAAGGG + Intronic
907504628 1:54908980-54909002 GCTTTGGAAATGAAGAGTAAAGG + Intergenic
907902269 1:58751770-58751792 TCTTTGCAGATGAAGAGCATAGG + Intergenic
909368870 1:74861052-74861074 GCAATGGAGATGATGAGAAAAGG + Intergenic
909380875 1:74997015-74997037 GATTTGGATATGAAGGGTATGGG - Intergenic
909730094 1:78879133-78879155 GTTCTGGAGATAAAGAGTAAAGG - Intergenic
911058814 1:93730556-93730578 GATTTGGATATGCAGAGTACAGG - Intronic
911216962 1:95205239-95205261 ACAGTGGAGATGAAGAGAAATGG + Intronic
911759392 1:101598948-101598970 GCTTTGGAGATGAGGAGTAAAGG + Intergenic
911967550 1:104386820-104386842 ACTTTGGAGAGGAAGAGTGAAGG - Intergenic
912885138 1:113463176-113463198 CCATTGGAGATGTAGAGTAGTGG + Intronic
913697530 1:121341914-121341936 GCTTTGGAGATGGTGAGAAGTGG + Intronic
914140029 1:144938138-144938160 GCTTTGGAGATGGTGAGAAGTGG - Intronic
914747198 1:150509438-150509460 GCTGTGGAGATCAAGAGTGTAGG - Intronic
915511716 1:156390329-156390351 GCCTTGGAGATGGAGGGCAATGG - Intergenic
915834053 1:159160250-159160272 GCTTTGTGGATGAAAAATAAGGG - Intergenic
916577472 1:166080604-166080626 GCCATGAAGATGAAGAGAAAAGG - Intronic
916664820 1:166957275-166957297 GCTTTAGAGAGCAAGAGAAAGGG + Intronic
918110080 1:181447887-181447909 GCTTTGAAGATGGAGAGAAGAGG - Intronic
919134437 1:193490078-193490100 GCATTGGAGATGGAGATGAAGGG - Intergenic
919195616 1:194281219-194281241 GCTATGGAGATTAACAATAAAGG - Intergenic
919678583 1:200410352-200410374 GCGTGGGAGATGCAGAGAAAGGG + Intergenic
920548906 1:206841660-206841682 GCTTTGAAGAGCAAGAGTTAGGG + Intronic
920710686 1:208291970-208291992 GCTTTGGAGAAGAAAAGGTAAGG - Intergenic
920831376 1:209468877-209468899 GCCTTGGAGATGAATAGGACAGG - Intergenic
920908674 1:210193949-210193971 CTTCTGGAGATAAAGAGTAAAGG - Intergenic
921226426 1:213024596-213024618 TCTTGGGAGATGGAGAGAAAAGG - Intergenic
921520597 1:216150851-216150873 ACTTCGGAGATGAAGAGTAAAGG - Intronic
922369118 1:224891892-224891914 GTTCTGAAGATGAAGAGTAAAGG - Intergenic
922424461 1:225480489-225480511 TCTTTGCAGATGAAGAGTAGTGG + Intergenic
923075760 1:230607307-230607329 GCTTCGGAGATGAAGAGTAAAGG - Intergenic
924316799 1:242806288-242806310 GTTTTGAAGATTAAGATTAATGG + Intergenic
924457430 1:244229993-244230015 GCTTTGGACATGGAGACTAGCGG - Intergenic
924562088 1:245165352-245165374 GTTATGGAGATGAAGAATACAGG + Intronic
1062931176 10:1353718-1353740 GCTTTGGAGATGAGGAGGAAAGG - Intronic
1064038525 10:11936647-11936669 GCTTTTGAGATGCAAAGGAATGG + Exonic
1064171731 10:13039623-13039645 GCTTTGCAGATGGATAGTATCGG + Intronic
1065086439 10:22183313-22183335 GCCTTGGAGGTGGAGAGAAATGG - Intergenic
1065645296 10:27827631-27827653 TCCCTGGAGATGAAGAGAAATGG - Intronic
1067738483 10:48877724-48877746 GCTCTGGGGATGAAGTGTACAGG + Intronic
1067899555 10:50224798-50224820 TGTTTGGAGAAGAAGAGGAAAGG + Intronic
1068007913 10:51411896-51411918 GCTTTGGGGAGGAAAAGTAACGG + Intronic
1070746155 10:78935244-78935266 GCTCTGGGCATGAGGAGTAAGGG + Intergenic
1070971843 10:80573760-80573782 ATTTTGGAAATGAAGAGTAATGG - Intronic
1071771476 10:88733717-88733739 GCTGTGCAAATGAAGAGGAATGG - Intronic
1072020411 10:91393571-91393593 TGTGTGGAGTTGAAGAGTAAAGG + Intergenic
1073258556 10:102171459-102171481 GCTTTTGAGAGGAAGAGGGAGGG + Intergenic
1073709106 10:106018538-106018560 GCTTTGGAGATGAAGAGTAAAGG + Intergenic
1074265961 10:111903579-111903601 AGTTTGAAGATAAAGAGTAAGGG + Intergenic
1074305915 10:112278405-112278427 GCTTCAGAGATAAAGAATAATGG - Intergenic
1074927557 10:118088754-118088776 GCTTTGGAGATTCAGAGAAGGGG - Intergenic
1075057302 10:119229145-119229167 ATTTTGGAGCTGGAGAGTAAGGG + Intronic
1076099528 10:127764613-127764635 GCTATGGGGATGAAGAGCACAGG - Intergenic
1079850161 11:25522875-25522897 GCGTTGGAGATGAGACGTAATGG + Intergenic
1080201880 11:29681197-29681219 GCTTGGGAGACAAAGAGAAAGGG - Intergenic
1080899245 11:36472251-36472273 CCTTTGGAGTTGAAGGGGAAGGG + Intergenic
1081578235 11:44333081-44333103 GGTTTGGGGATGAAAAGGAAAGG + Intergenic
1081912285 11:46707426-46707448 GCTGTGGAAATGCAGAGAAATGG + Intergenic
1082639963 11:55647245-55647267 GCTTTGGAGATGAAGGAAAGGGG + Intergenic
1083534795 11:63457714-63457736 GCTTTGGAGATGAAGAGTAAAGG - Intergenic
1083650341 11:64199994-64200016 GCTTTGGAGGAGAAGAACAAAGG + Exonic
1084354831 11:68631035-68631057 GCTTCGGAGATGAAGAGTAAAGG - Intergenic
1084464607 11:69314859-69314881 GCCTTGGGGAGGAGGAGTAAGGG - Intronic
1084846762 11:71907030-71907052 CCTTAGGAGATTAAGAATAATGG + Intronic
1085811185 11:79682746-79682768 TCTTTGGAAATGAAAATTAAAGG - Intergenic
1085970543 11:81585108-81585130 GCTTTGGAGATGAGTAGAATTGG - Intergenic
1086664773 11:89466972-89466994 CATTTGGAAATGAAGGGTAATGG + Intronic
1087197522 11:95315974-95315996 ACTTCAGAGATGAAGAGTAAAGG - Intergenic
1087384577 11:97454207-97454229 GCTTTCAAGATGAAGCTTAATGG + Intergenic
1087600334 11:100306356-100306378 TCTTTGGAGATAAAGAGATATGG + Intronic
1087993066 11:104769963-104769985 CCTTTGGAGAAGAGGAGAAAGGG + Intergenic
1089355159 11:117844814-117844836 GCTTTTTAGAAGAAGAGCAAGGG - Intronic
1089953970 11:122553795-122553817 GCTTTGGAGATGAAGAGTAAAGG - Intergenic
1089997211 11:122919560-122919582 TCTTTGAAGATGGAGGGTAATGG + Intronic
1090940181 11:131380557-131380579 GTTGTGGATATGAACAGTAAAGG - Intronic
1091091935 11:132779381-132779403 GATTTTAAGATAAAGAGTAAGGG - Intronic
1091337033 11:134779707-134779729 GCTGTGGGGGTGAAGAGAAAAGG + Intergenic
1091679324 12:2515532-2515554 GCTTTTGAGCTGAAGAGAATTGG - Intronic
1092580479 12:9835683-9835705 ACTTTGGAGATGAAGAGTAAAGG + Intronic
1092592370 12:9963985-9964007 GCTTTGGAGATGAAGAGTAAAGG + Intronic
1092615943 12:10215598-10215620 GGTTTGGAGAGGAAGAGAAGGGG - Intronic
1093024723 12:14235278-14235300 GTTCTGGAGATAAAGAGTAAAGG - Intergenic
1093359098 12:18201866-18201888 GCTTCGGAGATGAAGAGTAAAGG - Intronic
1093569293 12:20647686-20647708 GCTGTGGAAATGAACAGCAATGG - Intronic
1093951468 12:25167944-25167966 GCTTTGGAGATGAAGAGTAAAGG - Intronic
1094723548 12:33089619-33089641 GCTTTGGAGATGAAGAGTGAAGG + Intergenic
1094826387 12:34272400-34272422 GCTTTGGAGATAAAGAGTAAAGG - Intergenic
1095713500 12:45315912-45315934 GCAATGGAGATGAGAAGTAAGGG - Intronic
1095806133 12:46323015-46323037 GCTTTGGAGATGAAGAGTGAAGG + Intergenic
1096582559 12:52597021-52597043 GCTTTTTAGATGAAGGGTGATGG + Intronic
1096749289 12:53748448-53748470 ACTCTGGAGATGAAGAGAGACGG + Intergenic
1096905552 12:54932238-54932260 GTTCTGGAGATAAAGAGTAAAGG + Intergenic
1098129246 12:67331512-67331534 TCTTTGGTGATGAAGAGTTGTGG + Intergenic
1098179663 12:67832714-67832736 GCTTTGGAGAGGGACAGGAAGGG - Intergenic
1099246620 12:80200425-80200447 GCTTTGAAGATGAAGGAGAAGGG - Intergenic
1100110617 12:91237522-91237544 GTTTTGAAGATCAAGAATAAAGG + Intergenic
1100499386 12:95158960-95158982 TATTTGGAAATGAAGAGTCAGGG - Intronic
1101520565 12:105478542-105478564 GTGTTGGAGATAAAGAGTGAAGG + Intergenic
1101820641 12:108181472-108181494 GCCTGGGATAAGAAGAGTAAAGG + Intronic
1102074138 12:110046563-110046585 GCTTTGCAGATGAAGGGAACTGG - Intronic
1102455980 12:113071054-113071076 GCTTGAGAGATGAAAAGAAAGGG - Intronic
1102570563 12:113824793-113824815 GCCGTGGAGATGATGAGAAACGG - Intronic
1102711135 12:114928095-114928117 GCTTTGGAGATGTTGATCAAGGG - Intergenic
1104133385 12:125915983-125916005 TCTTTTGAAAGGAAGAGTAAAGG + Intergenic
1104334806 12:127884188-127884210 GCTAATGAGATGAAGAGGAATGG - Intergenic
1104456794 12:128921272-128921294 GGGTTGGAGATTAAGTGTAATGG - Intronic
1105032635 12:132894751-132894773 GCTTTGGAGATGAAGAATAAAGG - Intronic
1106019673 13:25902694-25902716 TCTTGGGAGATGAACAGTCAAGG - Intronic
1107095328 13:36529380-36529402 GATTTGGAGATGAAGATGTAGGG + Intergenic
1107353405 13:39540107-39540129 TCTTTGGAACTGAAGGGTAAGGG + Intronic
1109001223 13:56808432-56808454 GTGTTGGAGATGAAGCCTAATGG - Intergenic
1109173519 13:59126130-59126152 GTTTTAGTGAAGAAGAGTAATGG + Intergenic
1109652288 13:65344560-65344582 GGCTTGGAAATAAAGAGTAAGGG + Intergenic
1110708907 13:78627957-78627979 GCTTTGGAAATGAAGGGGATAGG + Intronic
1110896032 13:80753845-80753867 AGTTTGGAGATGAAGGTTAATGG + Intergenic
1111925195 13:94456370-94456392 GCTATGAAGAGGGAGAGTAAAGG - Intronic
1112092378 13:96094950-96094972 GCTCTGGACATGCAGATTAAGGG - Intronic
1113315397 13:109174236-109174258 GATTTGGAGCTCAAGAGAAAAGG + Intronic
1113634799 13:111912241-111912263 GCTTTGGTGAAGAGGAGCAAGGG - Intergenic
1115312213 14:31990679-31990701 GTTGTGGTGATGCAGAGTAAAGG - Intergenic
1115569485 14:34653230-34653252 GCTCTGGAGATAAAGAGTAAAGG - Intergenic
1116509370 14:45724981-45725003 ACTTTGGAGGTGAAGAGAAAGGG - Intergenic
1116807371 14:49507206-49507228 GGTTTTGACATTAAGAGTAAGGG - Intergenic
1117558614 14:56912010-56912032 ACTTTGGAGGTGAGTAGTAAGGG - Intergenic
1117636455 14:57749570-57749592 GCTTTGCAGTTGAAGTTTAAAGG + Intronic
1117652708 14:57923603-57923625 GCTTTGGAGCTGATGTGAAATGG - Intronic
1118003365 14:61543937-61543959 GATGTGGAGATGAGGAGTTAAGG - Intronic
1118226974 14:63910750-63910772 ATTTTGAAGATGAACAGTAAGGG + Intronic
1118936680 14:70295219-70295241 GCTTCGGATATGAAGAGTAAAGG + Intergenic
1119029524 14:71180991-71181013 GTTTTAGAGATGAAGAGTCATGG + Intergenic
1121219086 14:92272384-92272406 GCTTTGCGGATGAAGATAAAAGG - Intergenic
1121389364 14:93561176-93561198 GCTTTGGAGATGAAGAGTGAAGG + Intronic
1121618166 14:95327758-95327780 GCTGTGGAGATGGAGAGGAGAGG - Intergenic
1121666334 14:95675253-95675275 GTTTTAGAGATGAAGAATCAAGG - Intergenic
1121834948 14:97083705-97083727 GTTTTGGAAATTAAGAGTAAAGG + Intergenic
1122017495 14:98808563-98808585 TCTTTGGAGAGGAAGAGGGAGGG - Intergenic
1122041531 14:98991104-98991126 ACTTCAGAGATGAAGAGTAAAGG - Intergenic
1123784916 15:23661864-23661886 GCTGGGGAGGTGAAGAGTCATGG - Intergenic
1125104188 15:35951527-35951549 GCTTAGGAGTTGGAGAGAAAGGG + Intergenic
1125241928 15:37585954-37585976 TGTTTGGAGATGGAGAGTAGTGG - Intergenic
1126529773 15:49700047-49700069 ACTTTGGAGATAAAGAGTAAAGG + Intergenic
1127660705 15:61097792-61097814 ACATTGGGAATGAAGAGTAATGG - Intronic
1129074638 15:72982932-72982954 GCTTTGAAGATGAAGAAAAGGGG - Intergenic
1129315748 15:74742691-74742713 GCTTTGGAGAAAGACAGTAAAGG + Intergenic
1129350025 15:74950610-74950632 GCTTGGGAGATGAAGGGCAAGGG + Intergenic
1130009240 15:80135600-80135622 GGTTTGGAGATGAAAAAGAAAGG + Intronic
1130842778 15:87717086-87717108 GCTTTTGCCATGAAAAGTAATGG + Intergenic
1133766196 16:8839732-8839754 ACTTTGGAGATGAAGAGTAAAGG + Intronic
1134254813 16:12602192-12602214 GCTTTGGAGATGAAGGAAAAAGG - Intergenic
1134867991 16:17626085-17626107 GCTGAAGAGATGAAGAGTTAAGG + Intergenic
1135557218 16:23447070-23447092 GCAGTGAAGATGATGAGTAATGG - Intronic
1137054740 16:35739078-35739100 GCTTTGGAGATGAAGAGTAAAGG + Intergenic
1137482311 16:48862594-48862616 GCTACGGAGATGAAGTGTAGGGG - Intergenic
1138758466 16:59516752-59516774 GCTTCGGAGATGAAGAGTAAAGG + Intergenic
1141343026 16:83221088-83221110 GCTTTGGAGCTGAAAAGAAATGG - Intronic
1143925022 17:10361977-10361999 GATTTGGGGATGAAAAGCAAAGG - Intronic
1144113821 17:12066303-12066325 TCTTTGGAGATAAATATTAAGGG - Intronic
1146525031 17:33559737-33559759 GCTTTGAAGATGACATGTAAGGG + Intronic
1148744753 17:49912004-49912026 GCTTTGGAGATTCAGAGTTGGGG + Intergenic
1149683708 17:58522794-58522816 GGTTTGGAGAGGTAGAGGAAAGG - Intronic
1150935927 17:69635693-69635715 GCTGTGGAGATGGACAGAAAAGG + Intergenic
1152454598 17:80406421-80406443 GTTCTGGAGACAAAGAGTAAAGG - Intergenic
1152844264 17:82590105-82590127 GCTTTGGGGATGAAAACTATGGG - Intronic
1153091299 18:1346986-1347008 GCCTTGGAGAGGAAAATTAAGGG - Intergenic
1153809955 18:8743630-8743652 GCTTTGAAGATGAAGAAAGAGGG - Intronic
1155416055 18:25601154-25601176 GCAGTGGAGATGAAGAGGAGTGG - Intergenic
1155796978 18:30051142-30051164 GGTTTGGAGATGAATGATAATGG + Intergenic
1156237780 18:35220766-35220788 GCTTTGGAGATGAAGAGTGAAGG - Intergenic
1156376976 18:36523522-36523544 GCTTCAGAGCTGAAGAGTTAGGG + Intronic
1156634699 18:39012892-39012914 GCTTTGGTGATACAGAGTATAGG + Intergenic
1156916419 18:42467986-42468008 ACTTTGGAGATGAAGACTGAAGG - Intergenic
1157382776 18:47235003-47235025 GGTTTGAAGTTGGAGAGTAACGG + Intronic
1158394114 18:57066436-57066458 GCTTCGGAGATGAAGAGTAAAGG + Intergenic
1158554790 18:58466272-58466294 GCTTTTGCAATGAAAAGTAATGG + Intergenic
1158649500 18:59273232-59273254 GCTTTGGAGACGGAGAGGAGAGG + Exonic
1160211237 18:76881930-76881952 CCTTTGATGATGAAGAGGAAAGG - Intronic
1162242300 19:9365070-9365092 GCTTTGGAGATGAAGAGTAAAGG + Intronic
1162287481 19:9750066-9750088 GTTCTGGAGATAAAGAGTAAAGG - Intergenic
1163899534 19:20089473-20089495 GCTTCGGAGATGAAGAGTAAAGG + Intronic
1165059565 19:33198500-33198522 GCTCTGGAAATGCAGAGTCATGG - Intronic
1166396995 19:42448726-42448748 GCTTTGGAGATGAAGAGTGAAGG + Intergenic
1166864569 19:45828052-45828074 GCTTTGGAGGTGAACAGAACAGG + Intronic
1166906973 19:46118216-46118238 ACTTTGGAGATGAATCATAACGG + Intergenic
1166949461 19:46416753-46416775 GCTTTGGGGATGAGGCCTAAGGG - Intergenic
1167901496 19:52625533-52625555 GCTTTGGAGATGAAGAGTGAAGG - Intronic
926114984 2:10207266-10207288 GCCATGGAGATGGAGAGAAAAGG - Intronic
928366042 2:30703811-30703833 GCTTTGGAGTTTAAGAGTCTTGG + Intergenic
928770441 2:34698013-34698035 GCTTTGGAGATGAACAGTAAAGG + Intergenic
928778685 2:34794501-34794523 GCTATGGAGATGAAGAGTAAAGG - Intergenic
929261780 2:39874169-39874191 TCTTTGGAGATGTACAGTGAAGG + Intergenic
929370715 2:41221246-41221268 GCTGTGGAGGTGAAGGGTAGGGG + Intergenic
930098377 2:47584511-47584533 GTTCTGGAGATAAAGAGTAAAGG + Intergenic
930349010 2:50225334-50225356 GCTTAGTAGATGCATAGTAATGG - Intronic
930435512 2:51336223-51336245 TCTTTGGAGAGGCAGAGTAATGG + Intergenic
930958773 2:57233682-57233704 GCTTTGGAGATGAAGAGTAAAGG - Intergenic
931373018 2:61681795-61681817 GCTTTGTAGAAAAAGAGTCAAGG + Intergenic
931975312 2:67637684-67637706 GCCCTGCAGATGAAGACTAAGGG - Intergenic
932393869 2:71424741-71424763 GCTATGGAGATGAAAAAGAAGGG - Intronic
933343599 2:81053560-81053582 GCTTTAGGGGAGAAGAGTAAGGG + Intergenic
934141937 2:89055173-89055195 GCTTTGGAGATCAAGAGTGAAGG - Intergenic
934227300 2:90145373-90145395 GCTTTGGAGATCAAGAGTGAAGG + Intergenic
934623167 2:95828741-95828763 ACTTTGGGGAAGAAGAGGAAGGG + Intergenic
935476569 2:103530196-103530218 CCTTTGCAGAAGCAGAGTAAGGG - Intergenic
937238426 2:120444571-120444593 GCTTTTGGGATGAGGAGGAAGGG + Intergenic
938137901 2:128774363-128774385 GCTTTTGTGATGAATAGAAATGG + Intergenic
938602245 2:132854310-132854332 GCTTTGGGAATGAAGAGCAAAGG + Intronic
939178877 2:138781247-138781269 GCTTTGGAGAAGCAGAATAAAGG + Intergenic
940472602 2:154117427-154117449 ACTTTGGAGATGCAGGGTAAAGG - Intronic
940530660 2:154872776-154872798 GCTTTGGAGATGGAGAGTAAAGG - Intergenic
941293500 2:163705940-163705962 GTTTTCCAGATGAAGAGAAATGG - Intronic
941438965 2:165509468-165509490 GCTGTGGAGATGATGAGAAGTGG + Intronic
941455528 2:165709366-165709388 ACTTCGGAGATGAAGAGTAAAGG + Intergenic
943009835 2:182433764-182433786 GGTTTTGAGATGAAGGGTACAGG - Intronic
943412327 2:187559724-187559746 ACTTCAGAGATGAAAAGTAAAGG + Intronic
943503991 2:188730599-188730621 GCTTTGGTGATGATGATGAAAGG - Intergenic
943769950 2:191705410-191705432 GCTTTGGGGATAAAGGGAAAGGG + Intergenic
944251777 2:197586003-197586025 GCTTTGGAGATGAAGAGTGAAGG - Intronic
945500516 2:210567502-210567524 GCATTTTAGATGAAAAGTAAAGG + Intronic
945617234 2:212087048-212087070 GCTTCGGTGATGCAGAGAAAGGG + Intronic
947173463 2:227336516-227336538 ATTTTGGAGGAGAAGAGTAAAGG + Intronic
947352623 2:229262258-229262280 GCTTTGGAGATGAAACTTATGGG - Intronic
947565069 2:231188612-231188634 GCTTTGGAGTTGGGGAGAAAGGG - Intergenic
948923140 2:241076083-241076105 CTTCTGAAGATGAAGAGTAAAGG - Intronic
1168739686 20:177041-177063 GCTTTGGAGATGAAGAATAAAGG - Intergenic
1169138173 20:3210131-3210153 GCTATAGAGAGGAGGAGTAAAGG + Intronic
1169664008 20:8014493-8014515 GCTTTGGAGATAAACAGGGAAGG + Intronic
1169751899 20:9003237-9003259 GCTTTGGAGATGGGAAGAAAAGG - Intergenic
1169930389 20:10826513-10826535 GCTTTTGAGATGGAGAATATGGG + Intergenic
1170927600 20:20740121-20740143 ACTTTGGAGACGCAGGGTAAAGG + Intergenic
1171156556 20:22879899-22879921 GCTTTGAAGATAAAGAAAAAGGG - Intergenic
1171544536 20:25990253-25990275 ACTTTGGACATGGAGAGCAAGGG - Intergenic
1173118159 20:40265901-40265923 GCATTTGAAATGCAGAGTAAAGG + Intergenic
1173360252 20:42337815-42337837 ACTTTGGAGAGGAAAAGCAAAGG + Intronic
1174903732 20:54527838-54527860 GCTTTCTACAGGAAGAGTAAAGG + Intronic
1175749623 20:61486285-61486307 GCTTAGGAGCTGGAGAGTGATGG + Intronic
1176018351 20:62950016-62950038 ACTTCGGAGATGAAGAGTGCTGG + Intergenic
1178512581 21:33218203-33218225 GCTTTGAAGATGAAGTGTCAGGG - Intergenic
1181366356 22:22380139-22380161 CCTGTGGAGCTGAAGAGAAAGGG - Intergenic
1182300729 22:29335492-29335514 CCTCTGGAGATGGAGAGAAATGG - Intronic
1182702976 22:32255448-32255470 GCTTTGGAGAAGAGGTTTAAAGG - Intergenic
1182957081 22:34436555-34436577 GTTTTAGAGATGGAGAGGAAAGG + Intergenic
949188842 3:1226452-1226474 GCTTCAGAGAAGAAGAGTGAGGG - Intronic
950219883 3:11186359-11186381 GCTGTGGTGATGATGAATAAGGG - Intronic
951331944 3:21379448-21379470 ACTTTGGAGATGAAGAGTAAAGG + Intergenic
951762155 3:26159402-26159424 TCTTTGGAGATGAAGAGTAAAGG + Intergenic
951806535 3:26650433-26650455 GATCTGGAAATGAAGAGAAAGGG + Intronic
952297534 3:32074416-32074438 GTTCTGGAGATAAAGAGTAAAGG - Intronic
953476932 3:43213257-43213279 GGTTTGGAGTTGAGGAGTCATGG + Intergenic
953620894 3:44531890-44531912 GCTGTGGAGATGGAAAGAAATGG - Intergenic
954163521 3:48738835-48738857 GTTTTGGAGATGAAGGGTACAGG + Intronic
954420235 3:50415063-50415085 GCTGTGGAGATGGAGAGTGTTGG - Intronic
954695449 3:52422323-52422345 GCTTTGAGGATGAAGGGTAGGGG + Exonic
956721207 3:72119319-72119341 GCTTTGGAGTCAAAGAGAAATGG - Intergenic
956923312 3:73954002-73954024 TCTTTGGAGATGAACTGCAAAGG - Intergenic
956965866 3:74459327-74459349 AGCTTGGAGATGAAGAGGAAAGG - Intronic
957543884 3:81611855-81611877 GCTTTTTTGATGAAGAGTCAGGG + Intronic
957877251 3:86163577-86163599 TCTCAGGAGATGGAGAGTAATGG + Intergenic
957911016 3:86620184-86620206 GCTGTGCAGATGAATAGAAAAGG + Intergenic
959360759 3:105388316-105388338 TCTGTGGAGATGAAGAATCATGG - Intronic
959659572 3:108851409-108851431 GATTTGGATATGAAGAGAAGAGG - Intronic
960260317 3:115560472-115560494 CCTTTGTAGATGTAGAGGAATGG + Intergenic
962339153 3:134567297-134567319 GATTGGGAGGTGAAGACTAAAGG + Intronic
962449105 3:135497001-135497023 AATTTGGAGATGACGATTAATGG + Intergenic
962658137 3:137570538-137570560 GCTATGGGTATGGAGAGTAAGGG - Intergenic
962925029 3:139985029-139985051 GCAGTGGAGATGGAGAGAAATGG - Intronic
963059039 3:141209961-141209983 GCTTTGGAGATGAAGAGTGAAGG - Intergenic
963320411 3:143804122-143804144 GCTTTGGAGATGAAGAGTGAAGG - Intronic
963503214 3:146154502-146154524 GCTCTTGAAATGAAGAGCAAAGG + Intronic
964099363 3:152970020-152970042 GCTGGGGAGATGGAGAGTTAAGG - Intergenic
965153439 3:165013099-165013121 GCTATGTAGATGAAGTGTAATGG + Intronic
965286279 3:166824347-166824369 GCTTCGGAGATGAAGAGTAAAGG + Intergenic
965335745 3:167429421-167429443 GCTTTGGAGATGAAGAGGGAAGG - Intergenic
965625860 3:170683589-170683611 GCTTCAGAGATGAAGAGTAAAGG + Intronic
966067470 3:175834413-175834435 GCTTCGGAGTTGAAGAGTAAAGG - Intergenic
966279767 3:178213084-178213106 GCTTTGGAGATGAAGAGTAAAGG - Intergenic
966778738 3:183565264-183565286 ACTTTGCAAATGAAGAGTCAAGG + Intergenic
967100681 3:186212912-186212934 GGTTTGCAGATGAAGGGGAAAGG + Intronic
967349035 3:188491308-188491330 GCTGTGGAGATTAAGAGTAGAGG + Intronic
967520707 3:190429084-190429106 AGTTTGGAGTTGAAGGGTAAAGG - Exonic
967987291 3:195104961-195104983 GCTTTGGAGACCAACAGTATTGG + Intronic
968110536 3:196042830-196042852 GCTTTGGCAATGAAAAGAAATGG - Intronic
968412377 4:401334-401356 GTTCTGGAGATAAAGAGTAAAGG + Intergenic
968956353 4:3721708-3721730 GCCTTGGAGATGAAGAAAAATGG - Intergenic
970937774 4:21594921-21594943 GTTTTGGTCATGAAAAGTAATGG + Intronic
971181877 4:24336133-24336155 GCTCAGGAGATGAAGGGGAACGG - Intergenic
972343820 4:38176259-38176281 CATTTGAGGATGAAGAGTAAAGG + Intergenic
972422166 4:38898307-38898329 CCTTGGGAGAGGATGAGTAAGGG - Intronic
975134011 4:70856744-70856766 GCAATGGAGATGAAGAGAAGAGG + Intergenic
975630932 4:76401528-76401550 GCTTGAGATATGAAGAGAAACGG + Intronic
975785207 4:77880299-77880321 GCTTTGAAGATGAAGGATGAGGG - Intronic
975931112 4:79524013-79524035 GTTTTGATGATGTAGAGTAAGGG - Intergenic
976179447 4:82385178-82385200 GCTTTGAAGATGAAGGGAGAAGG + Intergenic
977042213 4:92029333-92029355 ACTTCGGAGATGAAGAGTAAAGG - Intergenic
977459504 4:97307758-97307780 GCTTTGGGGAAGAAGAGGTAAGG + Intronic
978218050 4:106231398-106231420 GCTTTGGAGATGCAAGGTTATGG + Intronic
979411692 4:120386860-120386882 GCTTTGGAAATGATGCCTAAGGG - Intergenic
980104597 4:128575774-128575796 GCACTGGAGATGAAGAGGAAAGG - Intergenic
982150875 4:152455756-152455778 GCTTTGAAGATGAAGGGAAGGGG - Intronic
982953440 4:161730563-161730585 GCTTTTCATATGAAGAGTAGAGG - Intronic
983685721 4:170406226-170406248 GCTTTGGAGATGAGAGGTAGGGG + Intergenic
983824945 4:172248303-172248325 GCTTTGTAGATGCACAGCAAGGG + Intronic
984155031 4:176186260-176186282 GCTTTGGACATGCAGTGAAAAGG - Intronic
984164966 4:176295777-176295799 GCTTTGGAGATGAAGAGTAAAGG + Intergenic
988354628 5:30157908-30157930 ACTTTGGAGAGGAAGGGAAAAGG - Intergenic
988937775 5:36106289-36106311 GTCCTGGAGATGAAGAGAAAAGG - Intronic
989548124 5:42698097-42698119 GTTTTGGAGAGGAAGAGCAAGGG + Intronic
989695646 5:44197263-44197285 TCCTGGGAGATGAAGAGAAAAGG + Intergenic
989804763 5:45589443-45589465 GCTTTTGGGATGACAAGTAAAGG + Intronic
991938914 5:71831343-71831365 GGTTTTGACATGAAAAGTAATGG + Intergenic
992077701 5:73206389-73206411 GCTTTGAAGATGAAGGGAGATGG - Intergenic
992796329 5:80257393-80257415 GCTTAGGAGTAGAAGAGGAAAGG + Intergenic
993274122 5:85834687-85834709 GCCTTGGAGATGAGGTGTAGGGG + Intergenic
993604354 5:89970007-89970029 GTGTTGGAGATGAAGAGAAGTGG + Intergenic
994497042 5:100526034-100526056 ACTTTGGAGATGTAGGGGAAAGG + Intergenic
994870800 5:105348263-105348285 GCTTTGGTGAGGAAGAGGAGGGG - Intergenic
994909629 5:105886066-105886088 CTTTTAGAGATGAAGAGTACAGG + Intergenic
995124787 5:108569396-108569418 GCTTTGGAGCTGAAGAGTAAAGG + Intergenic
995931981 5:117456422-117456444 TCTCTTGAGATGCAGAGTAAAGG - Intergenic
996139507 5:119888707-119888729 GCTGTGGAGTTGGAGAGTAGTGG + Intergenic
996358098 5:122618686-122618708 GCTCTGGAGATGAAGAGTAAAGG + Intergenic
996674413 5:126157735-126157757 ACTTTGGAGATGATGACTTAGGG + Intergenic
996752170 5:126899911-126899933 GCTTTGGTGATGATGTGTCAAGG - Intronic
997157975 5:131578692-131578714 GTTCTGGAGATAAAGAATAAAGG - Intronic
997355413 5:133259755-133259777 ACTGTGGAGATGAAGAGGAAGGG + Intronic
998296243 5:140971657-140971679 GAATTAGAGAGGAAGAGTAAGGG + Intronic
998887899 5:146713636-146713658 GCTGTGGAGGTGAAGAGAACTGG + Intronic
999809479 5:155114552-155114574 GGGTTGGAGATAAAGAGTACTGG + Intergenic
1000934429 5:167291205-167291227 GCTATGGAGAAGAAGAGTATAGG - Intronic
1001033761 5:168281973-168281995 GCATTGGAGATGTAGAAGAAAGG + Intergenic
1001436038 5:171700113-171700135 GCATTGGAGTTGAAGAAAAAAGG - Intergenic
1001821053 5:174710621-174710643 GCATTGGAAATGGAGAGTCAGGG - Intergenic
1004632626 6:17436558-17436580 GGTTTGGAGAGGAAGAGAGAGGG + Intronic
1006325370 6:33349662-33349684 GCTTCGGAGATGAAGAGTAAAGG - Intergenic
1006497133 6:34431869-34431891 CCTGTGGTGATGGAGAGTAATGG + Intergenic
1006865580 6:37206779-37206801 GCCTTGGAGGTGGAGAGTCAGGG - Intergenic
1007300321 6:40863146-40863168 GTTTTGGAGATGAAGAGTGAAGG + Intergenic
1007872224 6:45053563-45053585 GCTTTAGGGATGAAGGGTGAAGG - Intronic
1008627799 6:53335107-53335129 GCTTTGGGGATCAAGAGAAGTGG - Intronic
1008849829 6:56011729-56011751 GCTTTGGAGATGAAGAGTAAAGG + Intergenic
1008902043 6:56631567-56631589 GCTAAGGAGATGAACAGTAAGGG - Intronic
1009343844 6:62589970-62589992 GCTTCAGACATGAAGAGTAAAGG - Intergenic
1009751393 6:67882780-67882802 GCCTTGGAGGTAAAGAGTAAAGG + Intergenic
1010586080 6:77659793-77659815 GCTTCGGAGATGAAGAGTAAAGG + Intergenic
1011021451 6:82817988-82818010 ATATTGGATATGAAGAGTAAGGG + Intergenic
1014209520 6:118693240-118693262 GGTTTGGAAATGGAAAGTAAAGG - Intronic
1015630805 6:135230158-135230180 GCCATGGAAATGAAGATTAAAGG - Intergenic
1016205083 6:141458930-141458952 GCTTTGGAGATGAAGAGTAAAGG - Intergenic
1016441730 6:144091431-144091453 GCATTGGAGATAGAGAGGAAAGG - Intergenic
1017922154 6:158882140-158882162 GTTCTGGAGATAAAGAGTAAAGG + Intronic
1017975112 6:159350297-159350319 TCTATGGAGATGCACAGTAAGGG - Intergenic
1021261705 7:18466500-18466522 GCTTTGAAGATAAAGAAAAAGGG - Intronic
1021419185 7:20425776-20425798 TATTTGGTGATGATGAGTAAAGG + Intergenic
1021715872 7:23461641-23461663 GCTTTGGAGGTAATGAGTAGTGG - Intronic
1022093634 7:27124374-27124396 GCTTTGGTGATGAAGTGGGACGG - Intronic
1023841837 7:44102538-44102560 GCTTTGCAGAGGATGAGGAAAGG + Intergenic
1024234922 7:47390805-47390827 GCTCTGGCGATGGAGAGTAGGGG - Intronic
1024396452 7:48874525-48874547 GATTTGGGGATGAACAATAAGGG - Intergenic
1025249528 7:57342738-57342760 GCTGTGGAGGTGAAGAGGCAGGG - Intergenic
1025839082 7:65127119-65127141 GCTTTGGAAGTGAAAAGTACTGG + Intergenic
1025883985 7:65568846-65568868 GCTTTGGAAGTGAAAAGTACTGG - Intergenic
1025889460 7:65633760-65633782 GCTTTGGAAGTGAAAAGTACTGG + Intergenic
1028681077 7:93532816-93532838 GCTTTGGACATGAGGAATCAAGG - Intronic
1030080987 7:105777642-105777664 GCCGTGGAGATGGAGAGAAAAGG - Intronic
1030194163 7:106836733-106836755 GCTTTGGAGATGAAGAGTGAAGG - Intergenic
1030939427 7:115627983-115628005 GCTTTGAAGATGGAGAAAAAGGG + Intergenic
1031014455 7:116558034-116558056 GATTTGGAGAGGAAGAACAATGG - Intronic
1031852993 7:126888217-126888239 GCTTTGGAAGTGAAAAGTACTGG - Intronic
1033009027 7:137599479-137599501 ACTTTGGAGATGCACATTAATGG - Intronic
1033775828 7:144609921-144609943 GCTTTGGAGTTTAGGATTAAAGG + Intronic
1034084436 7:148310959-148310981 GCTTTGGAGATGAAGAGTAAAGG + Intronic
1034641462 7:152607313-152607335 GCTTTGGAGCTCAAGAAGAATGG + Intergenic
1036064194 8:5359347-5359369 GCTGTGCAGATGAAGAGAAGGGG + Intergenic
1036262114 8:7249300-7249322 GCTGTGGTGATGAATACTAAAGG - Intergenic
1036304476 8:7590258-7590280 GCTGTGGTGATGAATACTAAAGG + Intergenic
1036314153 8:7707839-7707861 GCTGTGGTGATGAATACTAAAGG - Intergenic
1036355329 8:8038250-8038272 GCTGTGGTGATGAATACTAAAGG + Intergenic
1038258067 8:25969424-25969446 GCTTTTGAGAACAGGAGTAAAGG + Intronic
1039798686 8:40936252-40936274 GCTTGGGACATGAAGACGAAAGG + Intergenic
1040773959 8:51016083-51016105 GATTAGGGGATGAACAGTAAAGG + Intergenic
1042497520 8:69471593-69471615 GCTTTGGAGCAGGAGAGTACAGG + Intronic
1043600830 8:81936290-81936312 GAGTTGGAGACGAGGAGTAAAGG - Intergenic
1043866995 8:85386471-85386493 GCTTTTGAGATGATGATTTAGGG - Intronic
1044194246 8:89355156-89355178 GTTTTGGTTATGAAGAGAAAGGG + Intergenic
1044542226 8:93420848-93420870 GCTTCTTAGATGAAGAGTAATGG - Intergenic
1044839637 8:96326863-96326885 GCATTGAAGATGCAGAGGAAGGG + Intronic
1044994859 8:97829445-97829467 GCTTTGGAGGTGAAGAGTAAAGG + Intronic
1046770549 8:118112415-118112437 GCTATGTAGAGGAGGAGTAAGGG - Intergenic
1047568782 8:126074659-126074681 GCTTTGAAGATGAAGAGAGGAGG - Intergenic
1048550451 8:135428459-135428481 GCTCTGGAGACAGAGAGTAAGGG + Intergenic
1048917886 8:139201875-139201897 GGTTTGGAGGTGAGGGGTAAGGG + Intergenic
1050165324 9:2759138-2759160 GCTTGAGAGGTGAAGAGTGAGGG - Intronic
1050226184 9:3458499-3458521 CCTATGGAGTAGAAGAGTAATGG + Intronic
1051064912 9:13091845-13091867 GCTTTAGAAATGAAAAGTACAGG - Intergenic
1051993042 9:23176580-23176602 GTTTTGGTGATGAAGAGGGATGG - Intergenic
1052219121 9:25998207-25998229 GCCTTGGAGGTGAAGAGTAAAGG - Intergenic
1052236978 9:26222729-26222751 GCTATGGAGATGGAGTGAAATGG - Intergenic
1052514067 9:29457219-29457241 TCTTTGGAAATGAAGACAAAGGG + Intergenic
1052653943 9:31332861-31332883 GCTTTAGAGATGAAGAGTAAAGG - Intergenic
1053387155 9:37701896-37701918 GCTGTGGAGATGGAAAGAAATGG + Intronic
1055347334 9:75352696-75352718 GCTTTGGAGATGAAGAGTAAAGG + Intergenic
1056324502 9:85465109-85465131 GCTTTGGAGATGAAGAGTAAAGG - Intergenic
1057887253 9:98839164-98839186 GCCTTGGACATGAAGCCTAAGGG - Intronic
1058162093 9:101580806-101580828 GCTTTGGAGCTGAACAGAAATGG - Intronic
1058274480 9:103023303-103023325 GGTCTAGAGATGAAGAGTCATGG - Intergenic
1058634088 9:107019589-107019611 GCTTTAGAGATGAAGAGGGAAGG + Intergenic
1058935164 9:109763307-109763329 TCTATGGAGATGGAGAGAAAAGG - Intronic
1059301501 9:113317283-113317305 GCCTTGGAGATGGAGGATAATGG + Intronic
1059935757 9:119308872-119308894 TCTTTGGATCTGAAGAGTCAGGG - Intronic
1060092374 9:120754603-120754625 ACTTTGGAGAGGTAGAGAAAAGG - Intronic
1060254140 9:122012131-122012153 TCTTTGGAGATGAGGAAAAAGGG + Intronic
1185714610 X:2331018-2331040 GCTCTGGAGATGTCCAGTAATGG + Intronic
1186602469 X:11052834-11052856 GCTTTGGTAGTGCAGAGTAAAGG + Intergenic
1188200293 X:27288009-27288031 GCTTTGGAGATGAAGAGTGAAGG + Intergenic
1191088603 X:56596729-56596751 TCTTTGGAGAAGAGGAGTACTGG + Intergenic
1191761948 X:64655804-64655826 ACTTTGGAGATGAAGAGTAAAGG - Intergenic
1191841790 X:65518454-65518476 GCTTTGAAGATGCTGAGCAAAGG + Exonic
1192763852 X:74123331-74123353 GTTCTGGAGATAAAGAGTAAAGG + Intergenic
1193148083 X:78097882-78097904 GCTTGGGAGAGTAACAGTAATGG - Intronic
1193208878 X:78782098-78782120 GCTTTGAAGATAAAGGGGAAAGG - Intergenic
1193921688 X:87435740-87435762 GCAATAGAGATGAAAAGTAATGG - Intergenic
1195758494 X:108222447-108222469 GCCTTGAAGGTGAACAGTAAAGG - Intronic
1195909973 X:109879266-109879288 GCATTGGAGATGAATGGAAATGG + Intergenic
1196226830 X:113177700-113177722 GCTTTGGAGATGAAGAGTAAAGG + Intergenic
1196338270 X:114565016-114565038 GCATTGGAGATGAAGAGAAAGGG + Intergenic
1196525088 X:116721865-116721887 GCTTTGGAGATGAAGAGTAAAGG + Intergenic
1196581368 X:117383042-117383064 ATTTTGGAAATGGAGAGTAAGGG - Intergenic
1196773330 X:119317347-119317369 GCTTTGGAAAGGAAGACTCAAGG - Intergenic
1196928322 X:120656073-120656095 GCTGTGGAGTTGAAGAGGAAGGG - Intergenic
1196997932 X:121404430-121404452 TCTTTGGTGATGGAGAGTGATGG - Intergenic
1199140125 X:144301364-144301386 GCTTTGGAAATGAACAGTCCAGG - Intergenic
1199234737 X:145478043-145478065 GCTGTGGGGATGAAGAGGAAGGG + Intergenic
1201220308 Y:11762831-11762853 GTTTTGAAGATAAAGATTAATGG + Intergenic
1201233665 Y:11890172-11890194 TCTTTGGAGCTGAAGAGTGAAGG + Intergenic
1201540433 Y:15100141-15100163 GCTTTACATATGAAGAGTGAAGG + Intergenic
1201723667 Y:17131809-17131831 GCTTTGGGGATGAAGTGTGAAGG + Intergenic
1201757872 Y:17507134-17507156 GCTATGGAGAAGAACAGCAATGG - Intergenic
1201843682 Y:18398848-18398870 GCTATGGAGAAGAACAGCAATGG + Intergenic
1201937738 Y:19425874-19425896 GCTTTGGAGATGAAGCATAAAGG - Intergenic