ID: 1055349692

View in Genome Browser
Species Human (GRCh38)
Location 9:75373536-75373558
Sequence TGGGATACAGTGCTTCCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055349689_1055349692 5 Left 1055349689 9:75373508-75373530 CCATTATCTTACATCACTGGGCT No data
Right 1055349692 9:75373536-75373558 TGGGATACAGTGCTTCCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055349692 Original CRISPR TGGGATACAGTGCTTCCCAA TGG Intergenic
No off target data available for this crispr