ID: 1055353841

View in Genome Browser
Species Human (GRCh38)
Location 9:75417433-75417455
Sequence CACTAGGACTGGAGGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055353835_1055353841 6 Left 1055353835 9:75417404-75417426 CCACTGTGGGCTGTTAGCATGAT No data
Right 1055353841 9:75417433-75417455 CACTAGGACTGGAGGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055353841 Original CRISPR CACTAGGACTGGAGGACTGT GGG Intergenic
No off target data available for this crispr