ID: 1055353907

View in Genome Browser
Species Human (GRCh38)
Location 9:75417929-75417951
Sequence CACTAGGAGTGGAGGGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055353896_1055353907 23 Left 1055353896 9:75417883-75417905 CCAGCACCAGGACTGGATGACTG No data
Right 1055353907 9:75417929-75417951 CACTAGGAGTGGAGGGCTGTGGG No data
1055353899_1055353907 17 Left 1055353899 9:75417889-75417911 CCAGGACTGGATGACTGTGGGCT No data
Right 1055353907 9:75417929-75417951 CACTAGGAGTGGAGGGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055353907 Original CRISPR CACTAGGAGTGGAGGGCTGT GGG Intergenic
No off target data available for this crispr