ID: 1055353919

View in Genome Browser
Species Human (GRCh38)
Location 9:75418009-75418031
Sequence CAGTCCTCCAGTCCTAGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055353919_1055353923 7 Left 1055353919 9:75418009-75418031 CCGGCACTAGGACTGGAGGACTG No data
Right 1055353923 9:75418039-75418061 TTAGCATGATCACCGGCACTAGG No data
1055353919_1055353924 12 Left 1055353919 9:75418009-75418031 CCGGCACTAGGACTGGAGGACTG No data
Right 1055353924 9:75418044-75418066 ATGATCACCGGCACTAGGACTGG No data
1055353919_1055353925 15 Left 1055353919 9:75418009-75418031 CCGGCACTAGGACTGGAGGACTG No data
Right 1055353925 9:75418047-75418069 ATCACCGGCACTAGGACTGGAGG No data
1055353919_1055353928 23 Left 1055353919 9:75418009-75418031 CCGGCACTAGGACTGGAGGACTG No data
Right 1055353928 9:75418055-75418077 CACTAGGACTGGAGGACTGTGGG No data
1055353919_1055353922 0 Left 1055353919 9:75418009-75418031 CCGGCACTAGGACTGGAGGACTG No data
Right 1055353922 9:75418032-75418054 TGGGCTGTTAGCATGATCACCGG No data
1055353919_1055353927 22 Left 1055353919 9:75418009-75418031 CCGGCACTAGGACTGGAGGACTG No data
Right 1055353927 9:75418054-75418076 GCACTAGGACTGGAGGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055353919 Original CRISPR CAGTCCTCCAGTCCTAGTGC CGG (reversed) Intergenic
No off target data available for this crispr