ID: 1055353925

View in Genome Browser
Species Human (GRCh38)
Location 9:75418047-75418069
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055353919_1055353925 15 Left 1055353919 9:75418009-75418031 CCGGCACTAGGACTGGAGGACTG No data
Right 1055353925 9:75418047-75418069 ATCACCGGCACTAGGACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055353925 Original CRISPR ATCACCGGCACTAGGACTGG AGG Intergenic
No off target data available for this crispr