ID: 1055353935

View in Genome Browser
Species Human (GRCh38)
Location 9:75418097-75418119
Sequence CACTAGGACTGGAGGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055353926_1055353935 23 Left 1055353926 9:75418051-75418073 CCGGCACTAGGACTGGAGGACTG No data
Right 1055353935 9:75418097-75418119 CACTAGGACTGGAGGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055353935 Original CRISPR CACTAGGACTGGAGGACTGT GGG Intergenic
No off target data available for this crispr