ID: 1055353974

View in Genome Browser
Species Human (GRCh38)
Location 9:75418307-75418329
Sequence CACTAGGACTGGAGGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055353965_1055353974 23 Left 1055353965 9:75418261-75418283 CCGGCACTAGGACTGGAGGACTG No data
Right 1055353974 9:75418307-75418329 CACTAGGACTGGAGGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055353974 Original CRISPR CACTAGGACTGGAGGACTGT GGG Intergenic
No off target data available for this crispr